| Dictionary, Encyclopedia and Thesaurus - The Free Dictionary 1,885,553,355 visitors served. |
|
Dictionary/ thesaurus | Medical dictionary | Legal dictionary | Financial dictionary | Acronyms | Idioms | Encyclopedia | Wikipedia encyclopedia | ? |
AAAG |
0.01 sec. |
How to thank TFD for its existence? Tell a friend about us, add a link to this page, add the site to iGoogle, or visit webmaster's page for free fun content. |
|
| ? References in periodicals archive |
|---|
AAAG Annals of the Association of American Geographers AAAG Annals of the Association of American Geographers Sequence 5'-3' PCR product (bp) [beta]-actin (sense) AAGCAGGAGTATGACGAGGAGTCCG 500 [beta]-actin (antisense) GCCTTCATACATCTCAAGTTGG tPA (sense) GAAGAGAGGGCT CTGCTGTG 300 tPA (antisense) GAGAAGTACAGGG CCTGCTG PAI-1 (sense) CAGACCAAGAGCCT CTCCAC 202 PAI-1 (antisense) ATCACTTGGCC CATGA AAAG TFPI (sense) AAGTATGGTGGATG CCTGGG 226 TFPI (antisense) TGGCACGACACA ATCCTCTG Table 2. |
| Acronyms and Abbreviations |
| Free Tools: |
For surfers:
Free toolbar & extensions |
Word of the Day |
Help
For webmasters: Free content | Linking | Lookup box | Double-click lookup | Partner with us |
|---|