AAAT


Also found in: Medical.
AcronymDefinition
AAATAll America Auto Transport (car shipping)
AAATAdult Adolescent Alcohol Treatment (rehabilitation facility; Grand Junction, CO)
AAATAmerican Academy of Addiction Psychiatry
AAATAmerican Association for the Advancement of Technology
AAATArmy Advanced Aviation Technology
AAATAdvanced All Analysis Training
References in periodicals archive ?
In silico analysis undertaken at the National Center for Biotechnology Information (NCBI) identified genes involved in salinity tolerance, or rather, genes AY785147--SOS with 3660 bp and AF319481--CK1 with 4206 bp, described as: AY785147: SOS1-1-F, 5' GAAGAACTTTCGATGCAGGA-3 '; SOS1-1-R, 5'--ATTT C C C AG AAAT GAT G C AA-3'; SOS1-2F, 5'-TGGACAGATTAGCAGCAACA-3 '; SOS1-2-R, 5'-TTGGGTAGGAACAAGATCCA3' and SOS1-3-F, 5'-GCTCTAAT AAAGCGCACAGC-3 '; SOS1-3-R, 5' CCAACAATTACTTGGGTTGCGGGCTTCAG AAACTGACAGA-3'.
One caution: the relative lack of benefit from aspirin reported in the AAAT may be due to the fact that it was powered to detect a 25% reduction in the event rate between groups, whereas the ATT Collaboration study (18) found a 12% risk reduction in MI among those taking aspirin.
En las muestras positivas para VPH, con el sobrenadante de los cepillados cervicales y el ADN de plasma restaurado, se realizo tipificacion viral por PCR convencional de la region E6/E7 de los tipos virales 16 y 18 (VPH 16 iniciadores: sentido 5' ATCATCAAGAACACGTAG AG 3' y antisentido 5' GATCAGTTGTCTCTGGTTGC AAAT 3' y VPH 18 el sentido 5' GATTTCACAACAT AGCTGGG 3' y el antisentido 5' TGCCTTAGGTCCA TGCATAC 3').