Also found in: Medical.
AACTAmerican Association of Community Theatre
AACTAmerican Academy of Clinical Toxicology
AACTAmerican Association of Candy Technologists
AACTAirbus Active Learning and Competence-Focused Training
AACTAdvanced Application Certification Testing (NMCI)
AACTAcorn Approved Centre of Technology
AACTArts And Crafts Time
References in periodicals archive ?
AACT was launched in 2014 by the American Chemical Society (ACS), the world's largest scientific society.
AACT has a strong presence in the domestic market, where it invested significantly in strengthening branding and merchandising platforms.
D Northeastern Region Vice President Administrative Schoolboard for the AACT and Dayspring Christian University said.
Each sample (2 [micro]L cDNA) was tested with real-time SYBR Green PCR reagent (Life Technologies) with specific primers: 18S (forward: AGTCCCTG CCCTTTGTACACA; reverse: CGAT CCGAGGGCCTCACTA), GAPDH (forward: TGGCACAGTCAAGGCTGAGA; reverse: CTTCTGAGTGGCAGTGATGG), bone morphogenetic protein 2 (Bmp2) (forward: AAGC CAT C G AG G AACT TT CA GA; reverse: TCAC AGGA AATTTTGA GCTGGC), and osteocalcin (OCN): (forward: TCTGACAAAGCCTTCATGTCCA; reverse: AACGGTGGTGCCATAGAT).
Al Jazeera Services (AJSS) which holds a 37 per cent stake in AACT has been the best performing stock in the market year-to-date.
The company has also finalised its plans for placing orders for equipment," said A Suresh, Financial Controller of AACT, which has a dominant position in the domestic ceramic tiles market with its popular Al Shams brand.
Her showstopping performance of the famous song about "dreams that you dare to dream" garnered an award for Best Performance in a Cameo Role from the AACT International 2010 Community Theater Festival.
To determine the effect the inhibitors had upon influenza RNA levels, the ACT values of the inhibitor-treated samples were subtracted from the ACT values in the presence of solvent alone to yield a AACT value.
This will be in two phases of three million each a€"enabling a total investment of about RO12 million,a€Y said AACT Managing Director A.
With a MainStage, a Stage II, and 1,500 volunteers producing at least 25 shows this year, the year-long celebration includes hosting the AACT International 2010 in late June with shows from 14 theater troupes representing five continents.
Kay's multi-disciplinary background providing strategy development and operational oversight to the pharmaceutical, medical device and biotechnology industries makes her a perfect match for AACT, with our unique focus on collaboration between practice areas, " said Division Vice President Inder Kaul.