ACACA

AcronymDefinition
ACACAAcetyl-Coa Carboxylase-Alpha
ACACAAustralia-China Agricultural Cooperation Agreement (agriculture, fishing and forestry agreement)
ACACAAustralian Curriculum, Assessment and Certification Authorities (secondary education)
ACACAAlberta Community Art Clubs Association (Canada)
References in periodicals archive ?
We observed that G tended to inhibit ACACA transcription in animals treated with the middle dose, with this inhibition becoming statistically significant at 75 mmol G/kg chow (Fig.
Abbreviations: ACACA, acetyl-CoA carboxylase; G, geraniol; HMG-CoA, 3-hydroxy-3-methylglutarylcoenzyme-A; HMGCR, 3-hydroxy-3-methylglutarylcoenzyme-A reductase; LDL, low-density-lipoprotein; LDLR, low-density-lipoprotein receptor; MP, mevalonate pathway; RT-PCR, reverse-transcriptase-polymerase-chain reaction; SREBF2, sterol-regulatory-element-binding transcription factor; TG, triglyceride; VLDL, very-low-density-lipoprotein; VLDLR, very-low-density-lipoprotein receptor.
Gene Primer Sequence (5'-3') HMGCR Forward TGTCOTGATGGCAGCCTTG Reverse CGCGCTTCAGTTCAGTGTCAG LDLR Forward GCAGTAGCTCGCTCTCGTTG Reverse TGGCAATGGATCCCGGAAAG SREBF2 Forward AAGGCTGGCCCATAGCTTC Reverse GCAGTAGCTCGCTCTCGTTG VLDLR Forward AGCGCTTCTGTAGGACACAC Reverse CTTCAGCGCTGGCTCTGTTA ACACA Forward GACAGAGGAAGATGGCGTCC Reverse AGATGTGCTGGGTCATGTGG [beta]-actin Forward TCAAGATCATTGCTCCTCCTGAG Reverse CTCCTGCTTGCTGATCCACA Table 2 Effect of geraniol (C) in body and liver weight and in the food intake of mice during a 3-week experimental period.
05) down-regulated linearly or quadratically with the addition of palmitate (Table 4), and treatments with addition of 500 to 600 [micro]M palmitate had lower FASN, ACACA mRNA expressions than the control and those with addition of 200 to 400 [micro]M palmitate.
As shown in Table 5, expressions of FASN, ACACA, and SCD and FABP mRNA were decreased linearly or quadratically with incremental addition of stearate (p<0.
ACACA and FASN are two important genes implicated in de novo synthesis of milk fatty acid in bovine mammary tissues.
In the present study, the suppressing effects of stearate on ACACA and FASN mRNA abundance were shown, which was also in agreement with previous observations by Kadegowda et al.
The expression of SREBP1 target genes ACACA, FASN, and SCD was suppressed by rapamycin, suggesting a role for mTORC1 in de novo synthesis of fatty acids (Soliman, 2011).
5] Human genes: FASN, fatty acid synthase; ACACA, acetyl-Coenzyme A carboxylase alpha; SREBF1, sterol regulatory element binding transcription factor 1 SCD, stearoyl-CoA desaturase (delta-9-desaturase).