ACADL


Also found in: Medical, Wikipedia.
AcronymDefinition
ACADLAcyl-CoA Dehydrogenase, Long-Chain
References in periodicals archive ?
Sequences of primers used for qRT-PCR Forward primer Reverse primer ACAA2 AAGCCGCTAACGAGGCTGGC AAGCCGCTAACGAGGCTGGC ACADL AACATGGCGGCATCGGTGGG AACATGGCGGCATCGGTGGG ACSL1 TGAGTGCATAGGCTCGGCGC TGAGTGCATAGGCTCGGCGC ACADVL CCCGAGTGTGGGGCGACAAC AGTCGCTGGGCAGAGGTAGGC CPT1[beta] TCCGAGGCAGGAGCCCCATC TCCGAGGCAGGAGCCCCATC ECH1 GAGGCCCTGGACAGTGGGCT GAGGCCCTGGACAGTGGGCT HADHA AACCCAGACCCGGCAGTGCT AACCCAGACCCGGCAGTGCT PDK4 GCGCACTTGCTCTCGCTCGA GCGCACTTGCTCTCGCTCGA PGC1[alpha] CACCAAGAAAGGGCCGGAGCA CACCAAGAAAGGGCCGGAGCA PGC1[beta] AAGGTCCCACCCCGATCCCG AAGGTCCCACCCCGATCCCG PPAR[alpha] AGGCCCTGCCTTCCCTGTGA GCGGGCCACAGAGCACCAAT Glutamate CTCTGCTGTCCCGCACCCG GTCGTCTTCGCGGTCGGTGG Dehydrogenase 18S ribosomal TAGAGGGACAAGTGGCGTTC CGCTGAGCCAGTCAGTGTAG
Activation of PPARG promotes terminal differentiation through the induction of a range of genes important for TG formation through fatty acid oxidation among downstream pathways involving CPT2, ACADL, and ACOX2.
003 C-2 to C-3 short chain acyl-Coenzyme A dehydrogenase, ACADL 2.