ACADM


Also found in: Medical, Wikipedia.
AcronymDefinition
ACADMAcyl-CoA Dehydrogenase, Medium-Chain
References in periodicals archive ?
ACADM mRNA expression in other organs of Yanbian yellow cattle and Yan yellow cattle
ACADM mRNA levels were measured in the same samples in the two breeds (Figure 5C).
ACADM is the most important enzymes in the ACAD family which functions in the initial dehydrogenation step in the [beta]-oxidation of phenylbutyryl-CoA for C4 to C12 medium chain fatty acids (Illig et al.
In the present study, the ACADM gene was detected in most tissues, which may reflect its importance in energy production.
In summary, this study examined the expression levels of PPAR[gamma], FASN, and ACADM genes in different adipose tissues, LD, heart, liver, kidney, colon and lung in both Chinese Yanbian yellow cattle and Yan yellow cattle breeds, PPAR[gamma] and FASN mRNA expression levels were significantly higher in adipose tissues than in LD, which indicated that both genes play key roles in fat deposition.
Allelic diversity in MCAD deficiency: The biochemical classification of 54 variants identified during 5 years of ACADM sequencing.
Primer information for real-time qRT-PCR Name Gene ID Primer (5' to 3') PPAR[gamma] NM_181024 Sense: GATAGGTGTGATCTTAAC TGTC GGAT Anti-sense: CGCTAACAGCTTCTCCTTCTCG FASN NM_001012669 Sense: CTGGAGCGTGAGCACAACCTG Anti-sense: GTGTGGAGTCCGTCAGCTCAT ACADM BC102989 Sense: TGTGCCTATTGTGTAACAGAACCT Anti-sense: TCCATTGGTGATCCACATCTTCTGAC GAPDH NM_001034034 Sense: CGTGTCTGTTGTGGATCTGACCTG Anti-sense: CAACCTGGTCCTCAGTGTAGCCT
c) Population study of samples retained for interesting genotypes of ACADM, coagulation (F2, F5, MTHFRR and warfarin susceptibility (VKORC1, CYP2C19), courtesy of Associated Regional and University Pathologists and BioFire Diagnostics.