AGGG

AcronymDefinition
AGGGAdvisory Group on Greenhouse Gases
AGGGAdvanced Graph, Graph, Graph
References in periodicals archive ?
3] gene: F 5'-G CCTGGTGGTCATCGACTC-3' and R 5-AC AGGG CTCT GGAAGGCACTGCTCAGCTCAC GCACC-3' [19].
8] Specifically, the rs12722 T and rs71746744 AGGG allele of COL5A1 are associated with increased COL5A1 mRNA stability, which may lead to increased levels of type V collagen [alpha]1 chain synthesis.