ALDOA


Also found in: Medical, Financial, Wikipedia.
AcronymDefinition
ALDOAAldolase A
References in periodicals archive ?
Spot Accession number number Protein name M17 K22E Keratin, type II cytoskeletal 2 epidermal M18 Q6NTA2 HNRNPL protein M19 Q32Q12 Nucleoside diphosphate kinase M20 ALDOA Fructose-bisphosphate aldolase A M21 PEBP1 Phosphatidylethanolamine-binding protein 1 M22 PGAM1 Phosphoglycerate mutase 1 N13 GMFB Glia maturation factor beta N14 HSPB1 Heat shock protein beta-1 N15 TP1S Triosephosphate isomerase M23 PGAM1 Phosphoglycerate mutase 1 M24 ENOA Alpha-enolase Spot Theoretical Theoretical Number of number Gene name Mr pl peptide Score M17 KRT2 65,678.
Gene Sense (5'-3') Anti-sense (5'-3') Size (bp) ECH1 GTATTAGCCTTCGCCTCACT ATGGCATTCCTCTTGTTGG 160 PAFAHB ACCACCATTGCCTGACTG TAGGCTTGATGTTGTCCC 326 ERP29 CCTGGATACGGTCACTTTC TGTATGGGACTGGGlTTCTC 139 PSMB6 CTGGGAAAGCCGAGAAGT ATCCCCTCCTCAATACCT 150 ALDOA CTACCAGAAGGCGGATGAT CTCCACCATGCGCACAAT 313 TPI1 CTCAGAGCACCCGTATCAT GCAGGGAAAGGGCGATTA 225 PHGDH CAAGGTGACCGCTGATGT TTCCCAGGGTCTTTCCAT 278 ([beta]-Actin) CCTGCGTCTGGACCTGGCTG CTCAGGACGAGCAATGATCT 478
Selected gene lists based on pathway analyses (1) Ratio Gene name Symbol (L/MG) (2) p value Carbohydrate metabolism Glycolysis aldolase A, fructose-bisphosphate ALDOA 0.