AREG

(redirected from Amphiregulin)
Also found in: Dictionary, Medical, Encyclopedia, Wikipedia.
AcronymDefinition
AREGAuthors Rights Expert Group (EFJ)
AREGAmateur Radio Experimenters Group (Australia)
AREGAntarctic Research Evaluation Group
AREGAmphiregulin
AREGAberdeen Renewable Energy Group (Aberdeen, UK)
AREGAccreditation Regulations (higher education)
References in periodicals archive ?
In addition, the research team found that Iressa, a cancer drug that blocks the epidermal growth factor receptor, effectively stopped the proliferation caused by amphiregulin.
Phosphorylation of TNF-[alpha] converting enzyme by gastrin-releasing peptide induces amphiregulin release and EGF receptor activation.
The primers used were Msx2, forward: ggaagaccagatggaccaga, and reverse: tctgtatcaagtggccctgtc; amphiregulin, forward: aaggaggcttcgacaagaaa, and reverse: atccgaaagctccacttcct; and ribosomal protein L19 (a housekeeping gene), forward: atcgccaatgccaactcc, and reverse: tcatccttctcatccaggtca.
Results from gene expression profiles have shown that tumours that express high levels of the EGFR ligands epiregulin (EREG) and amphiregulin (AREG) are more likely to have disease control with cetuximab (EREG, P=0.
Expression of epiregulin and amphiregulin and K-ras mutation status predictdisease control in metastatic colorectal cancer patients treated with cetuximab.