References in periodicals archive ?
In this study, we found that B2M in whole unstimulated saliva can distinguish between SS and snSS, and also between SS and HC.
The authors gratefully thank Dr Dalene van Jaarsveld, medical officer at the Division of Clinical Haematology in the Department of Internal Medicine at Universitas Academic Hospital, Bloemfontein, for providing a list of all patients investigated for B2M in the diagnostic haematology laboratory.
The reference genes B2M, ACTB, and EF-1a, which have been commonly used in numerous homologous species studies, were chosen in the present study and specific primers were designed in our laboratory to obtain a qPCR product of approximately 120-300 bp in length and avoid hairpin and cross dimer.
In regression IV, B2M is negatively related to EE5 but insignificant depicting that the difference between market and book value of equity at the IPO are priced on the basis of growth prospects and therefore create low estimation errors.
Primer sequence, annealing temperature and PCR product size Gene Primer sequence(5'-3') Annealing Amplicon temperature size (bp) ([degrees]C) Lpin2 Forward TCCTCAGCCTTCAGGTCTTC 61 129 Reverse GCTGCTTGGTTATGCTCTCC Lpin3 Forward GCTGGCACTGACCTTCTTCA 61 91 Reverse GAGTCTTGGTTTCCTCCCTCTC B2M Forward GGGCTGCTGTCGCTGTCT 61 78 Reverse TTCTGGCGGGTGTCTTGAGT RPL13A Forward CTCAAGGTTGTGCGTCTGAA 61 141 Reverse TTTCCGGTAGTGGATCTTGG PCR, polymerase chain reaction.
Qualitative data of expressions normalized to multiple endogenous control genes, ACTB, B2M, and HPRT1, showed that, in the young passage 2 myoblasts, pyruvate kinase type M2 (PKM2) isoform is most abundantly expressed (1722, n = 2).
When they inhibited B2M in lab mice tests showed their learning and memory had improved.
The sequences of primers and fluorescence resonance energy transfer probe of B2M were as follows: primers, 5'-TGTCACAGCCCAAGATAG-3' and 5'CAAGCAAGCAGAATTTGGAA-3' and probe, 5'FAM-TCCATGATGCTGCTTACATGTCTCGA-BHQ- 1-3' (6).
M2 EQUITYBITES-April 29, 2014-Motorola Solutions investment arm invests in B2M Solutions
TELECOMWORLDWIRE-April 29, 2014-Motorola Solutions investment arm invests in B2M Solutions