BIRC5


Also found in: Medical.
AcronymDefinition
BIRC5Baculoviral IAP (inhibitor of apoptosis protein) Repeat-Containing 5
References in periodicals archive ?
1 F:TAGGAAACGTTGAGAGGGTA R:TAACCCCGAAATGAAAATAA BCL2L1 AF216205 F:ACTGAATCAGAAGCGGAAAC R:AAAGCTCTGATACGCTGTCC BIRC5 NM_214141 F:CCTGGCAGCTCTACCTCAAG R:GAAAGCACAACCGGATGAAT FAS AJ001202 F:AAGTTCCCAAGCAAGGGATT R:AATTTCCCATTGTGGAGCAG CASP3 NM_214131.
The inhibitor of apoptosis protein (IAP) survivin, encoded by the BIRC5 gene, was highly expressed in all MM primary tumors (12 samples) and cell lines (7 of 8) compared with normal pleura.
T]SL2, cathepsin L2; ESR1, estrogen receptor 1; GRB7, growth factor receptor-bound protein 7; GSTM1, glutathione S-transferase M1; ERBB2, v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian); MKI67, antigen identified by monoclonal antibody Ki-67; MYBL2, v-myb myeloblastosis viral oncogene homolog (avian)-like 2; PGR, progesterone receptor; AURKA, aurora kinase A; MMP11, matrix metallopeptidase 11 (stromelysin 3); BIRC5, baculoviral IAP repeat-containing 5 (survivin); ACTB, actin, beta; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GUSB, glucuronidase, beta; KPLPO, ribosomal protein, large, P0; TFRC, transferrin receptor (p90, CD71).