BR2


Also found in: Dictionary, Thesaurus, Medical, Encyclopedia.
AcronymDefinition
BR2Battle Royale 2 (movie)
BR2Blood Rayne 2 (video game)
BR2Bloody Roar 2 (video game)
BR2Balbiani Ring 2 (gene)
BR2Boilermaker Second Class (USN rating)
References in periodicals archive ?
The H2SO4 mediated bromination appeared to be of greater industrial utility due to the easy availability and economy of reaction involving Br2 and H2SO4.
The effects of single inoculation (Br 1, Br 2 and G) and that of the double inoculation (Br1 and Br2 + G + G) are highly significant compared to the control.
Level 3--Sequence of factors (biological, psychological and social) with biological focus/centering (Categories: BR1, BR2, BR3, BR4, BR5)
Then Br2 was added to one of the solutions (in this solution CHBr3 was not added), and in the other solution CHBr3 was added without adding the Br2.
m] Product ([degrees] size (bp) C) TP53 Exon 7 F: CTTGCCACAGGTCTCCCCAA 62 237 R: AGGGGTCAGCGGCAAGCAGA K Exon 1 F: ATGACTGAATATAAACTTGTGGTAG 56 115 Ras R: AATCCTCTATTGTTGGATCATATTC Table 2: Tumor tissue information Tissue/Sample Cancer type Storage time Histopathology X01 Adenocarcinoma 5 months Grade II A X02 Adenocarcinoma 5 months Grade III B BR1 Adenocarcinoma 8 months Grade II B BR2 Adenocarcinoma 8 months Grade IV BT1 Squamous Cell Carcinoma 2 months Grade II A BT2 Squamous Cell Carcinoma 2 months Grade II B Table 3: Yield and purity of DNA extracted by different methods.
44% Table 3: Mix Proportion for M 30 Grade Concrete Mixtures Mix Designation BC BR1 BR2 BR3 Ricehusk aSK Present (%) 0 5 10 15 w/b rati 0.
Genotypes BR2 and BRS195 presented the highest value of proembryoids/anther and FM404, BRS180 and SCARLETT presented the lowest value.
Joanna Walton, 12 Speldhurst Close, Bromley, Kent BR2 9DT
This review will concentrate on what BR2 contains that its predecessors do not, and the significance of these additions for our knowledge of William Blake.
National Childminding Association, 8 Masons Hill, Bromley, Kent, BR2 9EY Tel: 020 8464 6164 www.
i] 1 960 8 120 2 700 5 140 3 320 2 160 TABLE 2 The 12 Sessions First Institution Second Institution Session Name (Periods 1-9) (Periods 10-18) BUDA/MUDA sessions MB1 MUDA BUDA BM1 BUDA MUDA MB2 MUDA BUDA MB3 MUDA BUDA BM2 BUDA MUDA BM3 BUDA MUDA RBUDA/BUDA sessions BR1 BUDA RBUDA RB1 RBUDA BUDA RB2 RBUDA BUDA BR2 BUDA RBUDA RBUDA with conditional change to BUDA (a) RB3 RBUDA BUDA (periods 1-14) (periods 15-20) R4 RBUDA None (a) (periods 1-20) Notes: Experiments were conducted at the University of Mississippi in July 1993 (BUDA/MUDA sessions) and March 1994 (all sessions involving RBUDA).