BR2


Also found in: Dictionary, Thesaurus, Medical, Encyclopedia.
AcronymDefinition
BR2Battle Royale 2 (movie)
BR2Blood Rayne 2 (video game)
BR2Bloody Roar 2 (video game)
BR2Balbiani Ring 2 (gene)
BR2Boilermaker Second Class (USN rating)
References in periodicals archive ?
For more information on Cimetrics' BR2 routers as well as product and sales information, contact Cimetrics at 617-350-7550 or visit http://www.
Isometries of the primary circuit should be a schematic 3D view of the primary cooling circuit of BR2.
e Admiralty sent a young engineer, W O Bentley, to Humber to sort out the reliability problems they were having with a French engine they were making under licence that led to Humber being given the go-ahead to produce the superior and highly successful BR1, the Bentley Rotary engine and later its more powerful derivative, the BR2.
City, Reactor Age Country Province Facility Name (Years) Canada Rolphton, NRU Chalk 52 Ontario River The Netherlands Petten HFR 47 Belgium Mol BR2 47 France Saclay OSIRIS 42 South Africa Pelindaba SAFARI 43 Australia Sydney OPAL 2 % World Supply Power Output Country of Moly (Megawatts) Canada 33% 135 The Netherlands 33% 45 Belgium 10% 100 France 8% 70 South Africa 3% 20 Australia N/A 20
Then Br2 was added to one of the solutions (in this solution CHBr3 was not added), and in the other solution CHBr3 was added without adding the Br2.
m] Product ([degrees] size (bp) C) TP53 Exon 7 F: CTTGCCACAGGTCTCCCCAA 62 237 R: AGGGGTCAGCGGCAAGCAGA K Exon 1 F: ATGACTGAATATAAACTTGTGGTAG 56 115 Ras R: AATCCTCTATTGTTGGATCATATTC Table 2: Tumor tissue information Tissue/Sample Cancer type Storage time Histopathology X01 Adenocarcinoma 5 months Grade II A X02 Adenocarcinoma 5 months Grade III B BR1 Adenocarcinoma 8 months Grade II B BR2 Adenocarcinoma 8 months Grade IV BT1 Squamous Cell Carcinoma 2 months Grade II A BT2 Squamous Cell Carcinoma 2 months Grade II B Table 3: Yield and purity of DNA extracted by different methods.
44% Table 3: Mix Proportion for M 30 Grade Concrete Mixtures Mix Designation BC BR1 BR2 BR3 Ricehusk aSK Present (%) 0 5 10 15 w/b rati 0.
Joanna Walton, 12 Speldhurst Close, Bromley, Kent BR2 9DT
This review will concentrate on what BR2 contains that its predecessors do not, and the significance of these additions for our knowledge of William Blake.
i] 1 960 8 120 2 700 5 140 3 320 2 160 TABLE 2 The 12 Sessions First Institution Second Institution Session Name (Periods 1-9) (Periods 10-18) BUDA/MUDA sessions MB1 MUDA BUDA BM1 BUDA MUDA MB2 MUDA BUDA MB3 MUDA BUDA BM2 BUDA MUDA BM3 BUDA MUDA RBUDA/BUDA sessions BR1 BUDA RBUDA RB1 RBUDA BUDA RB2 RBUDA BUDA BR2 BUDA RBUDA RBUDA with conditional change to BUDA (a) RB3 RBUDA BUDA (periods 1-14) (periods 15-20) R4 RBUDA None (a) (periods 1-20) Notes: Experiments were conducted at the University of Mississippi in July 1993 (BUDA/MUDA sessions) and March 1994 (all sessions involving RBUDA).