CATTT

AcronymDefinition
CATTTContrast, Analogy, Theory, Target, Tale (methodology of a discourse)
CATTTCreating Alternative Thinking Through Theatre
References in periodicals archive ?
Under the CATTT, GAP was awarded an exclusive license within Mexico for the use of all of the technical assistance and industry knowledge of AMP or its shareholders over the lifetime of the contract.
However, the CATTT automatically renews for a period of an additional 5 years unless one of the parties notifies its counterparties of the termination of the contract at least 60 days prior to the then-current termination date.
Viral RNA was extracted by using the Trizol reagent (Invitrogen, Carlsbad, CA, USA) technique as described elsewhere, and the entire SRNA segment was amplified, applying a 1-step reverse transcription--polymerase chain reaction (RT-PCR) assay using the primers ORO N5 (5' AAAGAGGATCCAATAATGTCAGAGTT CATTT 3'), ORO N3 (5' GTG AAT TCC ACT ATA TGC CAA TTC CGA ATT 3'), ORO 1A (5' AGTA-GTGTACTCCACTAT 3') (6), ORONR 271 (5' CGACTG-GAACTGTGGGAAAT 3'), OROF593 (5' AAGTCCT-CCGGCAGAGGTAT 3') and ORO2S (5' AGT AGT GTG GCT CCA CAT 3') (6).