CCTAA

AcronymDefinition
CCTAAChinese Certified Tax Agents Association
References in periodicals archive ?
Gene name Sequences of the primer (5' [right arrow] 3') Sense Antisense GAPDH GACATGCCGCCTGGAGAAAC AGCCCAGGATGCCCT TTGT PPAR[gamma] TTTGAAACAAGCGGTGAA CCAC ACCATTGGGTCAGCT CITGTG C/EBP[beta] CAAGCTGAGCGACGACTACA CAGCTGCTCCACCTTCTTCT C/EBP[alpha] GAGCCGAGATAAAGCCAAACA CGGTCATTGTCACTGGTCAACT Adiponectin GATGCAGGTCTTCTTGGT CCTAA GGCCCTTCAGCTCCT GTC aP2 GTGATGCCnTGTGGGAAACCTCGAAG TCATAAACTCTTGTGGAAGTCACGCC GATA2 ACGGCGTCAAGTACCAGGTG TCCGCTGCTCTAGTCGTGG CHOP 10 GTCCCTAGCrTCGCTGACAGA TGGAGAGCGAGGGCTTTG TNF[alpha] TGTCTCAGCCTCTTCTCATT AGATGATCTGAGTGTGAGGG GLUT4 GTGACTGCAACACTGGTC CTA CCAGCCAGTTCCATTGTAG Gene name Annealing temperature ([degrees]C) GAPDH 50-60 PPAR[gamma] 55 C/EBP[beta] 60 C/EBP[alpha] 54 Adiponectin 55 aP2 60 GATA2 56 CHOP 10 56 TNF[alpha] 54 GLUT4 60