CDK1


Also found in: Medical.
AcronymDefinition
CDK1Cyclin Dependent Kinase 1 (protein)
References in periodicals archive ?
3 26 SYBR_CAPDH_rev TTGATTTTGGAGGGATCTCG 20 CCNA2, cyclin A2; CCNB1, cyclin B1; CDK1, cyclin-dependent kinase 1; CDK2, cyclin-dependent kinase 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GTSE1, G-2 and S-phase expressed 1; HIST, histone cluster; ITPR1, inositol 1,4,5-triphosphate receptor, type 1; MYC, myelocytomatosis viral oncogene homolog; RHOJ, ras homolog gene family, member J; SRGAP3, SLIT-ROBO Rho GIPase activating protein 3; TOP2A, topoisomerase (DNA) Il alpha 170 kDa.
The p21/WAF/Cip protein (p21) binds directly to CDK1, CDK2, and CDK4, and may act as a universal inhibitor of the CDKs' enzyme activity.
The synthesized 2-(2-fluorophenyl)-6,7-methyIenedioxyquinolin-4-one (CHM-1) promoted G2/M arrest through inhibition of CDK1 and induced apoptosis through the mitochondrial-dependent pathway in CT-26 murine colorectal adenocarcinoma eel Is.
AML), and CDK1, 2, and 9 are well-established anti-cancer targets due to their direct role in cell cycle control.
The protein expression of CDK1 related to the G2/M phase decreased markedly with daidzein treatment, whereas slight expression of cyclins A and B occurred.
Casgrande F, Darbon JM (2001) Effects of structurally related flavonoids on cell cycle progression of human melanoma cells: Regulation of cyclin- dependent kinases CDK2 and CDK1.
These assays included two biochemical targets, tyrosine kinase and the proprietary Ah-receptor, and two cell-based assays, proprietary CDK1 and HIV cell fusion.