CETP


Also found in: Dictionary, Thesaurus, Medical, Encyclopedia.
Related to CETP: LCAT, CETIP
AcronymDefinition
CETPCertified Employee Training Program
CETPChina Energy Technology Program
CETPCentre de Recherches en Physique de l'Environment Terrestre et Planetaire (French)
CETPCollaborations for Excellence in Teacher Preparation
CETPCommon Effluent Treatment Plant
CETPCholesteryl Ester Transfer Protein
References in periodicals archive ?
Plasma cholesterol and HDL-C concentrations and LCAT and CETP activity were measured by the methods described below.
The CETP was built at a huge cost of Rs800 million and the industries department is reported to be demanding more funds to run it.
A 535 bp fragment in the intron 1 of the CETP gene was amplified by using the primers 5' CACTAGCCCAGAGAGAGGAGTGCC3' and 5'CTGAGCCCAGCCGCACACTAAC3.
Clinical data on HDL-C, ApoA-I, and HDL size (where available) in individuals with CETP deficiency and during pharmacological inhibition of CETP activity with torcetrapib, dalcetrapib, and anacetrapib were taken from the literature (16-19).
The images and structural analyses support the hypothesis that cholesterol is transferred from HDLs to LDLs via a tunnel running through the center of the CETP molecule.
Dalcetrapib reduced CETP activity by 49% and increased HDL cholesterol by 31% without affecting LDL cholesterol among patients with or at risk of coronary heart disease in the randomized phase II dal-VESSEL trial.
ApoAI induces the externalization of intracellular cholesterol from macrophages; LCAT esterifies externalized cholesterol, which is then partitioned into the hydrophobic core of the HDL particle; CETP catalyzes the equimolar exchange of cholesterol ester for triglyceride in VLDL and LDL in a process referred to as "indirect reverse cholesterol transport'; and SRBI mediates the selective uptake of cholesterol esters from HDL and allows the delipidated HDL to dislodge, reenter the circulation, and reinitiate another cycle of RCT.
What's more, the old people and their children are more likely than others to carry a variant form of a gene called CETP.
AVANT also announced the signing of an agreement with The Immune Response Corporation (Carlsbad, CA) for the acquisition of a portfolio of granted and pending patents covering products or methods for stimulating an immune response against CETP.
These five CETP projects involved 47 institutions of higher education.
Based on this method, called beta-quantification, anacetrapib 100 mg daily resulted in LDL-C reductions of approximately 25 to 35 percent, compared to the 40 percent reduction previously reported from the DEFINE (Determining the EFficacy and Tolerability of CETP INhibiition with AnacEtrapib) study and other anacetrapib studies.
and verify the status of combined effluent Treatment Plant of Kotri, and then submit work plan in consultation with the SITE Association of Kotri for running the CETP, by a constituted committee comprising the Industrialists and experts, sufficiently.