CREBBP


Also found in: Dictionary, Medical, Financial, Encyclopedia.
Related to CREBBP: EP300
AcronymDefinition
CREBBPCREB-Binding Protein
References in periodicals archive ?
Gene Forward primer (5'-3') Reverse primer (5'-3') P300 CTGTATGTGCTCCAGAAC GACAAAAAGGCAGTTCC CREBBP CTGCACACGACATGACT GAAGTGGCATTCTGTTG HDAC1 CAAGCTCCACATCAGTCCTTCC TGCGGCAGCATTCTAAGGTT HDAC2 AGTCAAGGAGGCGGCAAAA TGCGGATTCTATGAGGCTTCA HDAC7 CTTCTCCACAAGGACAAG CTCCAGGGTTCTGTAGG [beta]-actin GCACCACACCTTCTACAATGAGC GGATAGCACAGCCTGGATAGCAAC TABLE 3: Correlation analysis of global histone H3/H4 acetylation in [CD4.
Levels of OCT4 and CDX2 as well as CREBBP, JUN, ETS2 and IFNT mRNAs in peri-implantation conceptuses were examined by PCR using specific primers (Table 1).
From Table 3, in addition to TGF-131, the genes belong to TGF beta receptors, ACVR1B and TGFBR2, and co-activators, CREBBP, were up-regulated in NF3 treated fibroblast Hs27 cells.
DNA sequencing of CREBBP demonstrates mutations in 56% of patients with Rubinstein-Taybi syndrome (RSTS) and in another patient with incomplete RSTS.