E1B

AcronymDefinition
E1BEarly region 1B
References in periodicals archive ?
The best sellers at Ross' Grayghost Tactical are the SureFire E1B Backup and E2D Defender LED, with the standard G2X moving well around Christmas as a popular stocking stuffer.
Roles for the E4 orf6, orf3, and E1B 55-kilodalton proteins in cell cycle-independent adenovirus replication.
ca South East Rural Early Intervention Program PO Box 24051 Riverview, NB Canada E1B 4T6 (506) 386-4304 (506) 386-4305 (fax) Sussex and Area Early Intervention 717 Main St.
Examples here include the BHRF-1 protein of human Epstein-Barr virus (Figure 1) and the E1B 19kD protein of human adenovirus.
Like simian virus 40 (SV40) large tumour antigen and adenovirus E1B, the E6 protein of the "high risk" HPVs can complex with the p53 protein (16).
SureFire's E1B Backup Flashlight was honored as the Specialty Product of the Year.
Wild-type p53 mediates apoptosis by E1A, which in inhibited by E1B.
And, a live band will be playing at the carrier's new spacious facility addition between gates E1B and E1C.
Specialty Product of the Year--SureFire: E1B Backup Flashlight
We used transgenic animals carrying a reporter construct that consists of three estrogen-responsive elements (GAGCTTAGGTCACTGTGACCT) upstream of a minimal human E1B TATA promoter sequence (GGGTATATAAT) coupled to luciferase surrounded by chicken [beta]-globin insulator (Chung et al.
To take control of the cell, the virus must first inactivate p53, which it does by making a protein called E1B 55k.
Southwest Airlines will operate from gates E1A and E1B in Terminal E at Logan.