FLIC


Also found in: Dictionary, Idioms, Encyclopedia.
Related to FLIC: airdock
AcronymDefinition
FLICFunctional Living Index Cancer
FLICFault Location Indicating Console
FLICFloridians for Lower Insurance Costs
FLICFORTRAN Language for Industrial Control
FLICForward Looking Infrared Camera
FLICFlight Line Intelligence Center
References in periodicals archive ?
He said, "With Flic continuing to evolve in the coming years, we are well-poised to ride this momentum of worldwide adoption.
Similar to Schnur, legal scholar William Eskridge (1997) viewed the actions of FLIC as a microcosm of a larger phenomenon but did so through the eyes of the law.
After analysis, an internal primer pair was constructed: fliC 1C: AACTAACGGTACTAACTCTGACA and fliC1Crev: CCACTACCGTCTCAGCTTT to obtain a complete fliC sequence, because the entire gene was large and when the DNA sequencer (Megabace 1000 system) was used approximately just 600 pb were obtained.
As far as the FLIC was concerned, lesbians fit somewhere in the new cold war discourse of sexual and political perversion, but just where they fit was not clear to Johns and his colleagues.
The FLICs program is designed to give investors a less risky approach to investing in the entertainment sector.
At first, you will be taught to flic flac from a standing position to finish standing on two feet.
Because FLIC has hundreds of thousands of square feet of leasable outdoor space, it also is ideal for companies that require large amounts of open parking and storage areas.
Best notes that FLIC remains a formidable player in the pre-need life market, has demonstrated increasing operating strengths and overall profitable business growth and is committed to further earnings diversification through the variable annuity platform being acquired from Hartford Life Inc.
EG Industries inked the production and partnership deal to implement full-scale manufacturing of Flic for the globaal market and distribute it in Asia.
This is a critical moment for the two fledgling FLIC companies, (and) their success depends on a positive reception from the investment community," said Screen Producers Assn.
Best notes that FLIC remains a formidable player in the pre-need life market and has demonstrated increasing operating strengths and profitable business growth.