FMO3

AcronymDefinition
FMO3Flavin-Containing Monooxygenase3
References in periodicals archive ?
However, another group observed that although the blockade of FMO3 resulted in decreased TMAO concentrations, increased atherosclerosis was also observed.
sup][58] However, individuals without functional FMO3 often exhibit a fishy odor, which is caused by trimethylaminuria.
The gene for FMO3 can suffer from any of about 10 different mutations.
When they receive a high dose of choline, people with at least one copy of a mutated gene for FMO3 excrete high levels of smelly trimethylamine in their urine.
For example, various drugs, such as antidepressants, may be broken down by FMO3.
Indole-3-carbinole, which inhibits FMO3 and its relatives, seems to increase the effectiveness in mice of the pain medication codeine, Williams reports.
Two new polymorphisms of the FMO3 gene in Caucasian and African-American populations: comparative genetic and functional studies.
Expression of CYP1A2, CYP2C8, CYP2C18, CYP2C19, CYP2D6, CYP3A7, CYP4A11, FMO1, and FMO3 was below the limit of detection (LOD) in all investigated samples (data not shown).
1 CYP4B1 TGACCATGTGCATCAAAGGAG Other drug-metabolizing enzymes NM_000120 EPHX1 TGATGAGGGAGAGCGGGCTAC NM_002021 FMO1 GCTGTTCGAGTCCTGAAAGG NM_006894 FMO3 GGCAGGGCTAGCATTTACAA NM_001461 FMO5 CTCTCAGTTTCATATTGCCCAG NM_000846 GSTA2 GCCCAAGCTCCACTACTTCA NM_000561 GSTM1 TTCCCAATCTGCCCTACTTG XM_040116 GSTP1 ACCTCCGCTGCAAATACATC XM_003547 UGT2A1 TTGGCCAATGGAAGGTAGTC Nuclear transcription factors NM_001621 AHR CTGCCTTTCCCACAAGATGT NM_005122 NR1I3 GTCATGGCCAGTAGGGAAGA M10901 NR3C1 GCTCTGGGGTGGAGATCATA U22662 NR1H3 TCAACCCCATCTTCGAGTTC AF061056 NR1I2 TTGTTCGGCATCACAGGTAG Housekeeping gene NM_021130 Cyclophilin CTTGCCATTCCTGGACCCAA Product Accession no.