GEFDB

(redirected from GLUT4)
Also found in: Medical, Wikipedia.
AcronymDefinition
GEFDBGLUT4 (Glucose Transporter) Enhancer Factor DNA Binding Domain
References in periodicals archive ?
One of the primary ways cinnamon impacts blood sugar is by increasing production of GLUT4, a molecule that is responsible for transporting sugar from blood plasma into the cell, which enhances insulin sensitivity and therefore glucose uptake.
2), CTGGAAT TAACTGCTTCTACCT (forward), TACTCTGCGATTTGTCTT ATTGA (reverse); [beta]-casein (NM181008), CCTAACAGCCTCCC ACAAAA (forward), AGACTGGAGCAGAGGCAGAG (reverse); GLUT1 (NM_174602), CGGCTGCCCT GGAT GTC (forward), GCCTGGGCCCACTTCAAA (reverse); GLUT4 (BC114082.
2-fold, while the glucose transporter GLUT4 was overexpressed by a factor of 2.
O complexo PKB/Akt fosforilado promove a translocacao do GLUT4 e influxo de glicose (Ozes e colaboradores, 2001; Carvalheira e colaboradores, 2002; Thong e colaboradores, 2005; Luchs, 2006).
2015) Exercise causes muscle GLUT4 translocation in an insulin-independent manner.
The anti-diabetogenic bioactivity can be related to several mechanisms, as glycogen metabolism by enhancing the insulin signaling pathway or directly by activation of GLUT4 insulin independent.
The increase in oxidation rates in a mixed carbohydrate drink is hypothesised to be as a result of the increased uptake of mixed carbohydrates by GLUT4 and GLUT5 transporters respectively in the brush border of the gut.
One of the dietary supplements that has gained most notoriety is the mineral chromium, the literature states main functions potentiate the action of insulin with a better connection liver protein GLUT4 capturing more glucose and reduce the lipid profile inhibiting hydroxymethylglutaryl-CoA liver enzyme reductase.
42] The facilitative glucose transporter GLUT4 plays a key role in regulating whole body glucose homeostasis.
Inaguma T, Han J, Isoda H Improvement of insulin resistance by cyanidin-3-glucoside, anthocyanin from black beans through the up-regulation of GLUT4 gene expression BMC Proc.
Therefore, when the reduction of PI3K signaling pathway occurs, Akt will be activated and hence GLUT4 vesicle translocation and reduction of glucose transport will occur [52].