GP1

AcronymDefinition
GP1Glutathione Peroxidase 1 (biochemistry)
GP1Genetic Programming 1
GP1Growth Period 1 (life sciences)
References in periodicals archive ?
Woodman also teased that the GP1 processor opens up the possibility of adding new features to the Hero 6 Black through software updates.
Target Gene shRNA Target Sequence (22-mer) ID S2, env, rev SER1 AAGGAAGCAAGAGACCAAGAAA S2, env, rev SER2 ATGGCAGAATCGAAGGAAGCAA gag, pol GP1 AGTAGAGGATCTCAACCTGGAC gag, pol GP2 CACAACAAATCTGTTGTACAAG pol pol2 GACAGACACCATGGGAAGTATT S2 S2.
El GP1 concentra los estilos Famabalasto Negro sobre Rojo y Yocavil Policromo, ambos asociados a poblaciones trasplantadas como parte de politicas estatales procedentes del oeste catamarqueno.
He said that the regulations have become too restrictive, adding that they're in danger, chassis-wise, of becoming GP1.
By Sports Reporter/Doha The French trio of Cyrille Lemoine, Jeremy Poret and Jennifer Menard and Slovenian's Nac Florjancic won the first World Championship heats in the Runabout, Ski Division GP1, Ski Ladies GP1 and Freestyle categories at the UIM-ABP Aquabike Grand Prix of Qatar on Doha Bay yesterday.
Item-total >0,3 AP4 -0,485 Eliminado AP7 0,209 Eliminado ESCALA GESTION DE LOS PROCESOS GP1, GP2, GP3, GP5, GP6, GP7 Corre.
El objetivo de este estudio fue conocer la composicion de acidos grasos y la sensibilidad a la peroxidacion lipidica en diferentes muestras de semen fresco porcino de dos granjas, GP1 y GP2.
This The Gateshead group, chaired by local GP Mark Dornan, represents 34 GP1 practices across the area and covers a population of around 205,000.
Z = 4,369 - 0,925 x BPK1 - 2,6156 x GST1 + 16,8242 x TP1 + 4,5762 x IK1 + 2,6439 x GP1 + 0,9115 x SPK1 - 20,0507 x TVP/T1 + 5,3164 x NP/T1 + 39,0135 x TVP/P1 + 5,9507 x GST2 + 7,2504 x TP2 - 16,7569 x IK2 + 18,8240 x GP2 + 7,8331 x TVP/T2 - 12,2667 x NP/T2 - 41,6082 x TVP/P2 + 1,1088 x GST3 - 26,2628 x TP3 + 8,6205 x IK3 + 54,9958 x GP3 + 18,0501 x TVP/T3 + 9,7489 x NP/T3 - 4,1720 x BP3 - 7,0197 x TVP/ P3 - 5,8053 x GP/T3.