G3P

(redirected from Glyceraldehyde-3-phosphate)
Also found in: Medical.
AcronymDefinition
G3PGlycerol 3 Phosphatase
G3PGlyceraldehyde-3-Phosphate
References in periodicals archive ?
Sequences of primers for real-time PCR Gene Primer Primer sequence (5'-3') ssc-miR-34c-5p RT-Primer CTC AACTGGTGTCGTGGAGTCGG CAATTCAGTTGAGGCAATCAG F-Primer CCCGCCAGGCAGTGTAGTTA R-Primer CTCAACTGGTGTCGTGGAGTC U6 F-Primer CTCGCTTCGGCAGCACA R/RT-Primer AACGCTTCACGAATTTGCGT ZNF148 F-Primer GCCTTTAGAACGAACTATCAC R-Primer AGGTACTTCTGTATGAAACGC KLF4 F-Primer TCGGACCACCTTGCCTTACA R-Primer TTGGGAACTTGACCATGATTGTAG PDGFRA F-Primer TCCAGCAGTTCTACCTTCATCA R-Primer AGGAGTCTATGCCAATGTCGTC GAPDH F-Primer GTTTGTGATGGGCGTGAAC R-Primer ATGGACCTGGGTCATGAGT PCR, polymerase chain reaction; zinc finger protein 148(ZNF148), kruppel-like factor 4(KLF4), platelet-derived growth factor receptor alpha (PDGFRA) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
105 is inactive and 75 is active bands in ADAMTS5 Primary Primary Secondary Secondary antibodies antibodies antibodies antibodies concentration concentration Caspase-1 1/1000 Rabbit 1/4000 ADAMTS5 1/1000 Hare 1/4000 ADAMTS9 1/1000 Goat 1/4000 GAPDH 1/10000- Rabbit 1/4000 1/50000 Primary Reaction kDa antibodies Caspase-1 Mouse, rat, human 50 ADAMTS5 Mouse, rat, human 75/105 ADAMTS9 Mouse, rat, human 180 GAPDH Human 36 ADAMTS: A disintegrin-like and metalloproteinase with thrombospondin motifs; kDa: Kilodalton; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.
5) Human genes: TBP, TATA box binding protein; UBC, ubiquitin C; SDHA, succinate dehydrogenase complex, subunit A, flavoprotein (Fp); RLP13, receptor like protein 13; YHWAZ, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide; HMBS, hydroxymethylbilane synthase; B2M, fi-2 microglobin; hypoxanthine phosphoribosyltransferase 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RPS18, ribosomal protein S18; ACTB, actin, beta; GSS, glutathione synthetase (hGus); 36B4, acidic ribosomal phosphoprotein P0.
2d3, treatment with tBHP resulted in a decrease in the levels of glycolytic enzymes (M2 splice isoform of pyruvate kinase, lactate dehydrogenase (LDHA) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)) in the H9c2 cells, and TPG effectively ameliorated this deregulated enzyme expression.
Enhanced expression of a glyceraldehyde-3-phosphate dehydrogenase gene in human lung cancers.
We also quantified the transcripts of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an endogenous control to normalize each sample using sense and antisense primers, 5' CCA TCA CCA TCT TCC AGG AGC 3' (positions 278-298) and 5' GGA TGA TGT TCT GGA GAG CC 3' (positions 663-682), respectively (Tokunaga et al.
F-actin has been shown to bind glycolytic enzymes like fructose-l,6- biphosphate aldolase (aldolase) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
2006), the glyceraldehyde-3-phosphate dehydrogenase (GAPD) gene (Proceedings of the National Academy of Sciences, Li et al.
brucei, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was also evaluated for betulinic acid, olenaolic acid, ursolic acid.
Nicotinamide may use other mechanisms to preserve cellular energy metabolism that could depend upon glycolytic metabolism mediated by glyceraldehyde-3-phosphate dehydrogenase (Kaanders et al.
PCR primers for rat glyceraldehyde-3-phosphate dehydrogenase (G3PDH), IL-1, IL-6, TNF-[Alpha], IL-2, and IFN-[Gamma] were purchased commercially from Clontech (Palo Alto, CA); PCR primers for rat IL-4 and IL-5 were synthesized by the core facility of the Human Studies Division at the U.