HBEGF

AcronymDefinition
HBEGFHeparin Binding Epidermal Growth Factor
References in periodicals archive ?
Primers and probes for aQRT-PCR Gene (a) Real-time PCR primers, 5' [right arrow] 3' HER-2 Forward GGATGTGCGGCTCGTACAC Reverse FAM-AGTGCTATCCGAGGGAATGACATGGTTGGGACTCTTGAC GAPDH Forward ROX-GTGCTATCCGAGGGAACCTGACCTGCCGTCTAGAAAA Reverse CTCCGACGCCTGCTTCAC TOP1 (103 bp) Forward FAM-AGTGCTATCCGAGGGAAGACAGCCCCGGATGAGAAC Reverse AAGAATTGCAACAGCTCGATTG HBEGF (99 bp) Forward FAM-AGTGCTATCCGAGGGAACCCCAGTTGCCGTCTAGGA Reverse CGGACATACTCTGTTTGGCACTT TBP (108 bp) Forward FAM-AGTGCTATCCGAGGGAAGGGCATTATTTGTGCACTGAGA Reverse AGCAGCACGGTATGAGCAACTGTCAGA MYC (134 bp) Forward FAM-AGTGCTATCCGAGGGAATCCTCCTTATGCCTCTATCAT Reverse CCGCGCTTTGATCAAGAGTCC Antiprimer TTCCCTCGGATAGCACT-BHQ2 (a) Fragment length in parentheses.
The results of immunoblotting analysis confirmed the changes in gene expression at the protein level because protein levels of CDH1, HBEGF, and KRT13 in arsenical-treated cells and MC-T2 cells (Figure 5) agreed well with the mRNA levels measured by Q-PCR assay (Figure 4A).
a) Gene Forward primer Reverse primer CDH1 AACGCATTGCCACATACACTCT CATTCTGATCGGTTACCGTGATC E2F1 GAGCAGATGGTTATGGTGATCAAA AGGGCACAGGAAAACATCGA GAPDH GGAGTCCCTGCCACACTCA GCCCCTCCCCTCTTCAAG GJA1 CCAAAGACTGTGGGTCTCAA CTCACTTGCTTGCTTGTTGTA HBEGF AGGACTTCTGCATCCATGGA TGGTCATAGGTATATAAGCGAT IGFBP5 CTCACTTGCTTGCTTGTTGTA GCACTGCTTTCTCTTGTAGAA IL1R2 TGTGCTGGCCCCACTTTC GCACAGTCAGACCATCTGCTTT IL8 GTGCAGTTTTGCCAAGGA TTCTGTGTTGGCGCAGTG KRT13 GCGGGACTACAGCCCCTACTAC CCAGCCTGGCATTGTCAAT MMP2 GCACTGCTTTCTCTTGTAGAA GATCTGAGCGATGCCATCAA PRSS11 CCGTGGTTCATATCGAATTGT CCGTGGTTCATATCGAATTGT S100A8 TGGAGAAAGCCTTGAACTCTATCA GGTCTCTAGCAATTTCTTCAGGTCAT THBD GAGGACGTGGATGACTGCATACT GGTACTCGCAGTTGGCTCTGA VAV3 GAACAAGGGACACTCAAACTACCA GTTCCTAATGACCTGCATCTTTGG (a) Primer sequences were designed by Primer Express 2.