IGF2


Also found in: Medical.
AcronymDefinition
IGF2Insulin-Like Growth Factor 2 (also seen as IGF-II)
IGF2Insulin Growth Factor 2
References in periodicals archive ?
Van Laere AS, Nguyen M, Braunschweig M, et al A regulatory muta tion in IGF2 causes a major QTL effect on muscle growth in the pig.
001 Data is shown as Mean, Standard deviation and P- value, HDL: High-density lipoprotein, VLDL: Very low density lipoprotein, T2DM: Type 2 diabetes mellitus Table 3: Genotype and allele frequency of IGF2 gene in T2DM patients and controls Genotype T2D Controls Odds 95% CI P (n=100) (n=100) ratio AA 48 (48) 70 (70) 0.
The reason could be that diet alone is unable to oppose the altered levels of placental vascular endothelial growth factor, insulin and other growth factors (IGF1, IGF2 and IGF binding proteins) which regulate the placental development and are altered in GDM leading to thickened placenta and its cord.
The RT samples obtained were subjected to real-time PCR with primers specific for tilapia IGF1 (IGF1 forward primer: 5' CAGTGCGATGTGCTGTATCTCCT 3' and IGF1 reverse primer: 5' TCTTGGGAGTCTTGACAGGTGC 3') and IGF2 (IGF2 forward primer: 5' ACCCGTGGGATCGTAGAG 3' and IGF2 reverse primer: 5' GGGCATCACCGGTAT GAC 3').
Effect of frozen media on IGF2 expression of bovine embryos cultured entirely in vitro until day 14.
Additionally, victims of the famine that were in the first weeks of fetal development during the famine had changes in the DNA methylation patterns of a gene, IGF2, even six decades after the Dutch Hunger Winter.
BC-821 is a potential therapeutic product that penetrates cancerous cells and activates the synthesis of DTA under the control of H19 and /or P4 promoter of the target gene IGF2.
IGF2 overexpression in mice can induce mammary gland tumor growth after multiple pregnancies.
In a study of 79 newborns, Duke University researchers reported that the gene for IGF2 was less methylated--more turned on--in those born to obese fathers than in those born to normal-weight fathers.
Lower DNA methylation at the IGF2 gene was found when researchers examined DNA from the umbilical cords of 79 newborn infants and compared it to their parents' DNA.
The children of 16 obese men had lower levels of methylation of the gene IGF2 compared with the kids of normal-weight dads.