IPCR

AcronymDefinition
IPCRInternational Peace and Conflict Resolution
IPCRInverse Polymerase Chain Reaction
IPCRInstitute for Pediatric Clinical Research (Childrens Hospital Los Angeles, CA)
IPCRIntellectual Property and Competition Review (Australia)
IPCRInterfaith Peacebuilding and Community Revitalization
IPCRInterdisciplinary Programme for Cellular Regulation
IPCRInput Port Change Register
IPCRimmuno-polymerase chain reaction
IPCRInternational Patent Classification Reform
IPCRInstitute of Physical and Chemical Research (Saitama, Japan)
IPCRInstitute for Prostate Cancer Research
IPCRInterim Project Completion Report
IPCRIndex of Print Catalogues Raisonné
IPCRInformation Processing Center, Richmond
IPCRIngress Peak Cell Rate
IPCRInnings per Century Rate (cricket)
IPCRIndustrial Pollution Control Regulation
IPCRInterrupt Polarity Control Register
IPCRInfinity Property and Casualty Reinsurance
IPCRIntegrated Put/Call Ratio
References in periodicals archive ?
The NADiA PSA assay incorporates several improvements to the original qualitative IPCR assays (22, 23).
Oligo Sequence Methods name (a) (5' [right arrow] 3') IPCR 5' GDP F1 ATCACGCCCAATTCCGAY(A/C/T)TTC 5' GSP R1 CACAGCATTGTCTGCGTCATAAG 5' GSP F2 GTTCTGGTTCAGGTCGCATAC 5' GSP R2 AGAAGACCCCACCAGGCTAATG Universal 5' GSP F3 TCAGCAATGTCCGCCAAGACGAAG PCR 5' GSP R3 TAGGCCATCACCCGATCGTAGC GSP F1 GATGGCCTACAAGTTCCACGAG GSP R1 TGGCAGGGGTAGTGATAGA GDP F2 ATCACGCCCAATTCCGAY(A/C/T)TTC GDP R2 TGH(C/T)ACTCCGATGAAGTACTGGA GSP F3 GAGGTGCTCGGTGAGAACTG GSP R3 CTCGGGCTTGAGGTCTCGGTAG SON 3'GSP1 TGAGGAATCTGCCCGCTTCTACGC 3'GSP2 CCACTGCATGGGTGTCATCTAC IPCR 3' GSP F2 TCAAGCCCGAGAACCTGCTACTG 3' GSP R2 ATCCCTCCGTGTACTTGCTAACC 3' GSP F3 GAGGACTGGTGGGCGTTGGGAATC 3' GSP R3 CGGTAAGATTGAAGAACCCTGTG (a) GSP referred to genomic specific primer, while GDP referred to degenerated primer.
71) IPCR, (1913), 34; McDonald, "Business Leaders," 324-5; UBC, CFI, CMA, BC, Box 38-1, minutes, 23 August 1913.
Designed by seasoned communications technology professionals at LG-Ericsson USA, and built on the company's proven iPECS platform, the new iPECS IPCR enhances communication with ease, proving the flexibility and scalability of the LG-Ericsson communications solutions.
2(b)] using SON-PCR, while a [approximately equal to] 750 bp 3'flanking sequence was amplified through IPCR combined TAIL-PCR [Fig.
3] Nonstandard abbreviations: EMSA, electrophoretic mobility shift assay; IPCR, immuno-PCR; ExoIII, exonuclease III; ssDNA, single-strand DNA; dsDNA, double-strand DNA; TNF-[alpha], tumor necrosis factor a; Ct, threshold cycle.
Tickers featured: ACE, ALL, AXS, BER, CB, CNA, HIG, IPCR, PRE, PTP, RNR, TAP.
Tickers featured: ACE, AFL, AJG, HBG, HIG, IPCR, LNC, MET, MRH, NFS, PRU, RE, RGA, RNR, SCT, SFG, SPC, UHCO, XL.
Tickers featured: ACE, CB, HIG, IPCR, PGR, RNR, XL.
Tickers featured: AHG, AIG, BKS, HIC, INSUA, IPCR, JAKK, LFG, NAP, NETA, PIR, PRD, RMCI, RWT, SOL, STEI, TCC.
The USC-CHLA IPCR will use DataLabs' technology to support and conduct multi-site clinical trials for the testing of novel therapies for childhood diseases.
We do not like the potential IPCR merger for [Validus], as we believe the resulting combination would have too large a concentration of catastrophe exposed business (particularly heading into Atlantic hurricane season), as well as increased investment risk and an uncertain rating agency reaction.