IRF2


Also found in: Medical.
AcronymDefinition
IRF2Interferon Response Factor 2
References in periodicals archive ?
1 IRF2 F:aaactgggccatccatacag 192 R:ttagaaggccgctcagacat BC102948 ACTB F:ctcttccagccttccttcct 178 R:gggcagtgatctctttctgc
1 MS (PP) NA Inflammation 14 0 Ctrl related mechanisms (Chemokine receptor [up arrow], TNF-[alpha] R2 [up arrow], IRF2 [up arrow]) 2 MS (PP, RR) NA Biosynthesis of 18 3 Ctrl (pooled) pro- inflammatory leukotrienes (5-lipoxygenase [up arrow]) 4 MS (SP) NA IgFcR 22 [up arrow] in inactive 2 Ctrl lesions, G-CSF [up arrow] in active lesions.
2002) detected the expression of the mouse IRF2 mRNA in several tissues by RT-PCR and also found higher expression levels in lung, liver and much lower expression levels in brain, heart, which is consistent with our results in pigs.