IS2

0.04 sec.

Acronym	Definition
IS2	Iron Soldier 2 (Atari Jaguar game)

How to thank TFD for its existence? Tell a friend about us, add a link to this page, add the site to iGoogle, or visit webmaster's page for free fun content.

?Page tools

Printer friendly

Cite / link

Feedback

Your Ad Here

? References in periodicals archive
Upstream of imiR-2, a 142-bp sequence shared 76% nucleotide identity with part of the insertion sequence IS2. Carbapenemase-producing Enterobacteriaceae, U.S. rivers by Nordmann, Patrice / Emerging Infectious Diseases Through the joint venture with Neusoft and integration with IS2 the Company anticipates 2007 revenues of $21 million and gross profits of $6 million. Positron Corporation Research Coverage Initiated by Beacon Equity ... by Business Wire For amplification of IS6110 sequences, PCR analysis included the use of primers IS 1 (5'CCTGCGAGCGTAGGCG TCGG3') and IS2 (5'CTCGTCCAGCGCCGCTTCGG3'), designed to amplify a 123-bp fragment (nt 1,510-1,632) of the M. Molecular analysis of sarcoidosis tissues for Mycobacterium species ... by Blaser, Martin J. / Emerging Infectious Diseases More results

References in periodicals archive

Upstream of imiR-2, a 142-bp sequence shared 76% nucleotide identity with part of the insertion sequence IS2.

Carbapenemase-producing Enterobacteriaceae, U.S. rivers by Nordmann, Patrice / Emerging Infectious Diseases

Through the joint venture with Neusoft and integration with IS2 the Company anticipates 2007 revenues of $21 million and gross profits of $6 million.

Positron Corporation Research Coverage Initiated by Beacon Equity ... by Business Wire

For amplification of IS6110 sequences, PCR analysis included the use of primers IS 1 (5'CCTGCGAGCGTAGGCG TCGG3') and IS2 (5'CTCGTCCAGCGCCGCTTCGG3'), designed to amplify a 123-bp fragment (nt 1,510-1,632) of the M.

Molecular analysis of sarcoidosis tissues for Mycobacterium species ... by Blaser, Martin J. / Emerging Infectious Diseases

More results

Acronyms browser

Full browser

IS&T
IS-41
IS-CORE
IS-DFD
IS-IS
IS-LM
IS1

IS2
IS2000
IS2ME
IS3
ISA
ISA+21
ISA-DEMON
ISAA

Free Tools:	For surfers: Browser extension \| Word of the Day \| Help For webmasters: Free content \| Linking \| Lookup box \| Double-click lookup \| Partner with us

All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional.. Terms of Use.