IROB


Also found in: Wikipedia.
AcronymDefinition
IROBIndustrial Relations and Organisational Behaviour (UK)
IROBIn Range Out of Building (telephone device)
References in periodicals archive ?
PCR design and troubleshooting was reviewed and each student performed PCR amplification of iroB utilizing primer iroB F1: TGGACTGCTATACCCTGTGC and primer iroB R1: GCAGTATGCTCATGCTGGGC which yields a 493bp PCR fragment.
Address: IROB, Warwick Business School, University of Warwick, Coventry CV4 7AL, UK.