IROB


Also found in: Wikipedia.
AcronymDefinition
IROBIndustrial Relations and Organisational Behaviour (UK)
IROBIn Range Out of Building (telephone device)
References in periodicals archive ?
PCR design and troubleshooting was reviewed and each student performed PCR amplification of iroB utilizing primer iroB F1: TGGACTGCTATACCCTGTGC and primer iroB R1: GCAGTATGCTCATGCTGGGC which yields a 493bp PCR fragment.
Rapid detection of Salmonella enterica with primers specific for iroB.
He says it will be up to the border commission to rule on an issue that has threatened to sabotage the TSZ: Ethiopia's determination to keep troops stationed at Irob, an area north of the demilitarisation line originally agreed by the UN with the two governments.