NADH


Also found in: Dictionary, Medical, Wikipedia.
AcronymDefinition
NADHNicotinamide Adenine Dinucleotide
NADHNorth American Digital Hierarchy
NADHNicotinamide Adenine Dinucleotide plus Hydrogen
References in periodicals archive ?
Structural insight into the type-II mitochondrial NADH dehydrogenases.
thus, this methodology is not significantly affected by increased concentrations of pyruvate and LDH or consumption of NADH.
The regeneration of oxalacetate in glyoxylate cycle involves malate oxidation, which produces 1 NADH that yields 2.
Boveris, "Generation of superoxide anion by the NADH dehydrogenase of bovine heart mitochondria," Biochemical Journal, vol.
The fluorescence emission spectra of tryptophan (300-540 nm, resolution: 1 nm, slits: 5 nm) and NADH (400-740 nm, resolution: 1 nm, slits: 5 nm) were recorded with excitation set at 280 nm and 380 nm, respectively.
ana] con minimizacion de produccion de NADH como funcion objetivo [C.
Chlororespiration and poising of cyclic electron transport: plastoquinone as electron transporter between thylakoid NADH dehydrogenase and peroxidase.
That NAD+ has stimulatory effects on stress protein expression and autophagy, while mitochondria regenerate NAD+ from NADH, further integrates energy metabolism into proteostasis.
The use of carbon nanotubes decreases the oxidation potential of NADH to -0.
JX415820); NADH dehydrogenase subunit 1 (primers: NAD1-FF 5'-ATTGGKT TATTTCAGAGTTTTTCTGATT TA-3' and NAD1-RR 5'-CTCMC CATAATCAAATGGACTACG-3', 394 bp, GenBank accession no.
A atividade enzimatica foi determinada em espectrofotometro pelo monitoramento da oxidacao do NADH a 340nm por 2min a 30[degrees]C, em cubeta de polimetilmetacrilato, em meio de reacao de 1,5mL.
Electron transport chain: An electron transport system located in the mitochondria, in which electrons released by NADH are passed on to a series of other molecules that first accept the electrons and then pass them on to the next molecule in the chain.