ND1

AcronymDefinition
ND1NADH (Nicotinamide Adenine Dinucleotide) Dehydrogenase 1
References in periodicals archive ?
In this study, we investigated the genetic population structure of dolphinfish around Puerto Rico and in the western central Atlantic at 2 spatial scales, using the mtDNA ND1 gene.
The rock-solid performance, reliability, and operational efficiencies delivered by the Thinklogical KVM systems in our current EN1 and ND1 trucks made the decision to use Thinklogical again an easy one.
A 426-bp fragment of the mitochondrial ND1 gene was amplified with the primers ND for 2-AGTTTCGTAAGGGTCCTAATA and NDrev2-CCCACTAACTAA-CTCCCTTTC using the BD Advantage 2 PCR Kit (Becton Dickinson Biosciences, Franklin Lakes, NJ, USA) as described (7).
Nitrogen ND1 of His119 appears to be within a hydrogen-bond distance of the other apical oxygen, O7.
The ProMetric G imaging colorimeters are initially available in standard configurations consisting of the imaging colorimeter - ProMetric G2 or ProMetric G3 - with integrated color (X, Y, Z and Xb) and neutral density (ND0, ND1, and ND2) filters, as well as three lenses (20mm, 50mm, and 100mm macro) with full calibrations for all focus distances and usable aperture settings.
Genes in oxidative phosphorylation were upregulated, specifically ND1, ND6, ATP5E, ATP5F1, ATP6V1G2, ATP6V1G1, ATP6VOE2, ATP5L, COX11, COX15, COX7B, COX6C.
ND3 Levi Hughes helps ND1 Greg Lamar exit the former Soviet submarine Juliett 484.
In the recent study, Vaxart tested the ND1 vaccine using oral administration to ferrets, widely recognized as the most predictive animal model for influenza research.
To amplify ~1-Kb of the mitochondrial lrRNA (16S) to ND1 (NADH1) we used LRN-13398 (CGCCTGTTTAACAAAAACAT) (Simon et al.
Molecular systematics of the North American freshwater bivalve genus Quadrula (Unionidae: Ambleminae) based on mitochondrial ND1 sequences.
It says: 'Entry to the new ND1 would clearly need to be subject to similar conditions as governed its creation to ensure that ND1 remained for those clubs legitimately aspiring to the Premiership over and agreed time-frame.