NK2


Also found in: Medical.
AcronymDefinition
NK2Neurokinin Receptor 2
References in periodicals archive ?
The presence of nine NK genes in the oyster Pinctada fucata has been reported, however data are not available, except for Tlx and NK2 genes (Morino et al.
A nivel de soluciones nutritivas, como se ha mencionado anteriormente, los cvs que recibieron la solucion NK4 con relacion N/K 0,45 redujeron el numero de flores respecto a las soluciones nutritivas NK1, NK2 y NK3 (p [less than or equal to] 0,01).
Table 1: Primer details Gene Primer Sequence (5' [right arrow] 3') tcdA * NK11 F (5'TGATGCTAATAATGAATCTAAAATGGTAAC -3') NK9 R (5'CCACCAGCTGCAGCCATA -3') tcdA ([dagger]) NK3 F (5'GGAAGAAAAGAACTTCTGGCTCACTCAGGT-3') NK2 R (5'CCCAATAGAAGATTCAATATTAAGCTT-3') tcdB ([dagger]) NK104 F (5'GTGTAGCAATGAAAGTCCAAGTTTACGC -3') NK105 R (5'CACTTAGCTCTTTGATTGCTGCACCT -3') Annealing Gene Primer Length temp ([degrees]C) tcdA * NK11 30 55[degrees]C NK9 18 tcdA ([dagger]) NK3 30 55[degrees]C NK2 27 tcdB ([dagger]) NK104 28 55[degrees]C NK105 26 Product size Gene Primer (bp ([double dagger])) tcdA * NK11 1200bp NK9 tcdA ([dagger]) NK3 250bp NK2 tcdB ([dagger]) NK104 200bp NK105 * Repeating region, ([dagger]) Nonrepeating region, ([double dagger]) base pair.
Ejerce su accion a traves de tres receptores de la familia de la proteina G, denominados NK1, NK2 y NK3.
Las celulas de NK inmaduras o NK2 producen IL-5 e IL-13.
Tasikininler, mononukleer hucre ve granulositleri de iceren cesitli hedef hucrelerde bulunan 3G protein, NK1, NK2 ve NK3'u etkilerler.
Sequence alignments (tBlastn) using homeodomains of proteins belonging to NK2, NK3, NK4, NK5, NK6, NK7, Msx, Hex, and Tlx families were derived from Lottia gigantea, Branchiostoma floridae, and Ciona intestinalis genome contigs available at http://genome.
International TV sales so far include the BBC, Japan's NHK, Finland, the Netherlands and France's NK2.