NK3

AcronymDefinition
NK3Neurokinin Receptor 3
References in periodicals archive ?
Para el caso de calidad de flor, si bien se encuentran diferencias estadisticamente significativas entre el cv Codigo Rojo y la solucion nutritiva NK3 con relacion N/K 0,55 y el cv Pacific con la solucion nutritiva NK1 con relacion 1,16 se consideran como flores de buena calidad segun factor de evaluacion (Tabla VI).
A nivel de soluciones nutritivas, como se ha mencionado anteriormente, los cvs que recibieron la solucion NK4 con relacion N/K 0,45 redujeron el numero de flores respecto a las soluciones nutritivas NK1, NK2 y NK3 (p [less than or equal to] 0,01).
Table 1: Primer details Gene Primer Sequence (5' [right arrow] 3') tcdA * NK11 F (5'TGATGCTAATAATGAATCTAAAATGGTAAC -3') NK9 R (5'CCACCAGCTGCAGCCATA -3') tcdA ([dagger]) NK3 F (5'GGAAGAAAAGAACTTCTGGCTCACTCAGGT-3') NK2 R (5'CCCAATAGAAGATTCAATATTAAGCTT-3') tcdB ([dagger]) NK104 F (5'GTGTAGCAATGAAAGTCCAAGTTTACGC -3') NK105 R (5'CACTTAGCTCTTTGATTGCTGCACCT -3') Annealing Gene Primer Length temp ([degrees]C) tcdA * NK11 30 55[degrees]C NK9 18 tcdA ([dagger]) NK3 30 55[degrees]C NK2 27 tcdB ([dagger]) NK104 28 55[degrees]C NK105 26 Product size Gene Primer (bp ([double dagger])) tcdA * NK11 1200bp NK9 tcdA ([dagger]) NK3 250bp NK2 tcdB ([dagger]) NK104 200bp NK105 * Repeating region, ([dagger]) Nonrepeating region, ([double dagger]) base pair.
En decidua se hallaron principalmente celulas NK3 productoras de TGF-[beta] y muy escasas NK1.
Estos datos apoyan la hipotesis NK1/NK2/NK3/NKr1, asi tanto las NKr1 en sangre periferica como las NK3 en decidua pueden desempenar funciones importantes en el mantenimiento del embarazo por la regulacion de la funcion inmune materna (71).
The planned expenditure for the year is 4,793,863,326,283,000 new kwanzas (NK), with revenue put at NK3,880,103,863,202,000.
In addition, immunostains for organ-specific immunomarkers revealed tumor cells that were positive for paired box gene 8 (PAX-8) and negative for thyroid transcription factor-1 (TTF-1) and NK3 homeobox 1 (NKX3.
In 1995, two rows of four transgenic hybrids (BT1, BT3, BT6, BT7) and six nontransgenic hybrids (NK1, NK2, NK3, Mp704 x Mp707, Mp704 x Mp708, Ab24E x SC229) were grown to provide husks for a laboratory bioassay.
The first article uses 7 challenging yet representative examples to comprehensively review some diagnostic strategies and algorithms; to update many recently described diagnostic markers, such as von Hippel-Lindau tumor suppressor gene protein (pVHL), paired box gene (PAX) 8, ETS-related gene (ERG), sal-like protein 4 (SALL4), sex-determining region Y box (SOX) 10, NK3 homeobox 1 (NKX3.
1, NK3 homeobox 1; PSA, prostate-specific antigen; PSAP, prostate-specific acid phosphatase (original magnification X400 [A through D]).
The top 50 antibodies were chosen by the highest test volumes, the clinical importance of these antibodies, and the target antigen absence from normal tissues, such as thyroid transcription factor 1 (TTF1), napsin A, ER, PR, HER2/wew, GATA-binding protein 3 (GATA3), renal cell carcinoma marker (RCCma), [alpha]-methylacyl-CoA racemase (P504S), carbonic anhydrase IX (CAIX), von Hippel-Lindau tumor suppressor (pVHL), arginase-1, glypican-3, paired box gene 8 (PAX8), Wilms tumor 1 (WT1), caudal type homeobox 2 (CDX2), special AT-rich sequence-binding protein 2 (SATB2), S100, human melanoma black 45 (HMB-45), melanoma-associated antigen recognized by T cells 1 (Mart-1), CD3, CD20, CD10, CD15, CD30, myogenin, desmin, smooth muscle actin (SMA), chromogranin, synaptophysin, NK3 homeobox 1 (NKX3.