PGP9

AcronymDefinition
PGP9Protein Gene Product 9
References in periodicals archive ?
With total RNA of buffalo spermatogonial stem-like cell colonies as template, we found that germ cell marker Oct-4, PGP9.
Primers for amplification of germ cell marker genes Gene Forward (5'-3') Reverse (5'-3') Oct4 GTTCTCTTTGGAAAGGTGTTC ACACTCGGACCACGTCTTTC THY-1 CCAGAATACAGCTCCCGAACC AATATAAACCAGACGGAAGCAG PGP9.
In our study, apart from more typical morphological characteristics of SSCs and the higher intensity of immunocytochemical reactivity in percoll method compared to differential plating, regarding the superiority of two purification methods in separation of undifferentiated spermatogonia, higher PGP9.
Isolation, identification, and culture of goat spermato-gonial stem cells using c-kit and PGP9.
24% of cells in 45-60% and 30-45% Percoll layers, respectively were positive for PGP9.
70% of cells, enriched by differential plating method, were positive for PGP9.
To confirm the purity of these putative pigSSC colonies, we isolated mRNA from these colonies and performed RT-PCR with primer pairs specific for PGP9.
These cell colonies displayed morphology similar to that reported previously for miceSSC and were positive for SSC markers such as PGP9.
Four of the 6 monophasic synovial sarcomas exhibited 3+ immunoreactivity to PGP9.
5) Using polyclonal and monoclonal antibodies, Wilson et al (6) demonstrated that PGP9.
Three of our 9 control cases of leiomyosarcoma expressed PGP9.