RORC

AcronymDefinition
RORCRoyal Ocean Racing Club
RORCRehabilitation Outcomes Research Center (US VA)
RORCRight of Return Congress (international Palestinian lobby)
RORCRetailer Owned Research Company (Fort Worth, TX)
RORCReturn on Risk Capital (financial risk measure)
RORCReuters Order Routing for Commodities
References in periodicals archive ?
mRNA levels were determined by real-time PCR using the primers as follows: IFN-[gamma] forward, GTGGAGACCATCAAGGAAGAC; IFN-[gamma] reverse, TATTGCTTTGCGTTGGACAT; IL-4 forward, CGGCAGTTCTACAGCCACCA; IL-4 reverse, TCCTGTCGAGCCGTTTCAG; RORC forward, TGAGAAGGACAGGGAGCCAA; RORC reverse, CCACAGATTTTGCAAGGGATCA; IL-17 forward, GCTACGGTGCAGGTAAAGTTC; IL-17 reverse, GCAGAAGTGCATTTGACAAGAGA; GAPDH forward, ATCAAGATCATTGCTCCTCCTGAG; GAPDH reverse, CTGCTTGCTGATCCACATCTG.
On my visits to RORC (Royal Ocean Racing Club) I met the Commodore, who took me under his wing.
As the sailors grew more familiar with and confident on their new boat, so their results imporved and JMII clinched an impressive third place at the Raymarine Warsash Big Boat Spring Championship, before taking her first line honours victory in May's RORC Cervantes Trophy Race and then sealing her maiden overall event win a few weeks later in the RORC De Guingand Bowl.
In response to inquiries from foreign organizations who received offers from unidentified persons to conclude contracts for supply of petroleum products on behalf of RORC, TNK-?
With financial and developmental oversight of 47 corporate-owned retail stores in two states, Porritt co-developed a RORC cash management system and a register system with IT programmers to build a comprehensive program for all corporate stores; worked to consolidate the corporate entities ARS and AFM by streamlining systems, tools and processes; aided in the rollout of a new workforce management system to corporate retail stores; co-developed and facilitated the training curriculum for customer loyalty training meetings at retail stores; and had a direct influence on the improved morale and engagement of team members, among other 2011 accomplishments.
As an amateur sailor, it has been a dream of mine to experience the RORC Caribbean 600, which is considered a preeminent event in the international offshore racing calendar," said Groves.
Barnett, PhD; Department of Veterans Affairs-Research, 1601 SW Archer Road RORC (151B), Gainesville, FL 32608; 352376-1611; fax: 352-271-4540.
The MTXEPS solution integrates with Point of Sale software from ACR, AutoStar, Casio, IBM, Innovax, JDA, JPMA, NCR, Retalix, RORC Fujitsu Transaction Solutions, StoreNext, and Systech.
In this issue, you'll learn about RORC, the technology company owned by his company and two other co-op wholesalers, and how AWI and RORC service their retailers' technology needs via RORC's point-of-sale and back-office systems.
Originally, RORC was created just to develop a back-office system, according to Glenn Kriczky, VP of information systems for AWI.
Abbreviations: BRCC = Brain Rehabilitation Research Center of Excellence, BWS = body-weight support, FES = functional electrical stimulation, FNS = functional neuromuscular stimulation, I-SCI = incomplete spinal cord injury, LT = locomotor training, NCMRR = National Center for Medical Rehabilitation Research, NICHD = National Institute of Child Health and Human Development, RORC = Rehabilitation Outcomes Research Center, SCI = spinal cord injury, VA = Department of Veterans Affairs.