TGACC

AcronymDefinition
TGACCTherapeutic Goods Advertising Code Council (Australia)
References in periodicals archive ?
Xenopus 5' XGTC CAA AGT CA GGTCA CAG TGACC TGA TCA AAG TT 3' vit A2 ERE 3' CAG GTT TCA GT CCAGT GTC ACTGG ACT AGT TTC AA 5' Human 5' XGT CCA AAG TCA GGTCA CGG TGGCC TG ATC AAA GTT 3' pS2 ERE 3' CA GGT TTC AGT CCAGT GCC ACCGG AC TAG TTT CAA 5' Consensus 5' XGT CCA AAG TCA GAACA CAG TGTTC TGATC AAA GTT 3' GRE 3' CA GGT TTC AGT CTTGT GTC ACAAG ACTAG TTT CAA 5'
Amplification with the outer primers RS-3 (5' TGAAGTTAGTGCCCAGATGCAGG 3') and RS-4 (5' GCTCAGCGCCCAGTATA TGACC 3') yielded a 367-bp product.