TGTC

AcronymDefinition
TGTCThe Greater Than Club (band)
TGTCTexas Geometry and Topology Conference (mathematics)
TGTCThames Gateway Technology Centre (London, UK)
TGTCTobago Gas Technology Conference (University of Trinidad and Tobago )
TGTCTexas Gas Transmission Corporation
TGTCTexas Gymnastics Training Center (Mesquite, TX)
TGTCTachy Goes to Coventry (vBulletin forum software feature)
TGTCTrinity Gardens Tennis Club (Australia)
References in periodicals archive ?
Primer information for real-time qRT-PCR Name Gene ID Primer (5' to 3') PPAR[gamma] NM_181024 Sense: GATAGGTGTGATCTTAAC TGTC GGAT Anti-sense: CGCTAACAGCTTCTCCTTCTCG FASN NM_001012669 Sense: CTGGAGCGTGAGCACAACCTG Anti-sense: GTGTGGAGTCCGTCAGCTCAT ACADM BC102989 Sense: TGTGCCTATTGTGTAACAGAACCT Anti-sense: TCCATTGGTGATCCACATCTTCTGAC GAPDH NM_001034034 Sense: CGTGTCTGTTGTGGATCTGACCTG Anti-sense: CAACCTGGTCCTCAGTGTAGCCT
To amplify different BRCA1 splicing isoforms, we designed primers with the following sequences (5' to 3'): CATCCAAAGTATGGGCTACAGA (exon7fw), TGTC CAACTCTCTAACCTTG (exon8fw), ACATTGAATT GGCTGCTTGTG (exon8-11Afw), GTCTACATTG AATTGGTGTGGGAG (exon8-9fw), CCAGGGATG AAATCAGTTTGGA (exon10fw), GAATCCAAACT GATTTCATCC (exon10rev), TGGCTCCACATGCAA GTTTGT (exon11Brev), CGTCTCTGAAGACTGC TCA (exon12fw), CTGAGAGGATAGCCCTGAGCA (exon12rev), and TGGAAGGGTAGCTGTTAGAAGG (exon13rev).
6 TGTC like cpe Primer Ref Size genotype cpe location CPEmmF -12 1.