TPI1

AcronymDefinition
TPI1Triose Phosphate Isomerase 1
References in periodicals archive ?
This 100% provincially funded project uses TPI1 expertise and diverse requirements to assist in the on-going development and implementation of the pan-Canadian Panorama System for infectious disease control.
Gene Sense (5'-3') Anti-sense (5'-3') Size (bp) ECH1 GTATTAGCCTTCGCCTCACT ATGGCATTCCTCTTGTTGG 160 PAFAHB ACCACCATTGCCTGACTG TAGGCTTGATGTTGTCCC 326 ERP29 CCTGGATACGGTCACTTTC TGTATGGGACTGGGlTTCTC 139 PSMB6 CTGGGAAAGCCGAGAAGT ATCCCCTCCTCAATACCT 150 ALDOA CTACCAGAAGGCGGATGAT CTCCACCATGCGCACAAT 313 TPI1 CTCAGAGCACCCGTATCAT GCAGGGAAAGGGCGATTA 225 PHGDH CAAGGTGACCGCTGATGT TTCCCAGGGTCTTTCCAT 278 ([beta]-Actin) CCTGCGTCTGGACCTGGCTG CTCAGGACGAGCAATGATCT 478