hBD2

AcronymDefinition
hBD2Human Beta-Defensin-2
References in periodicals archive ?
On the other hand, the expression levels of hBD2 were higher in epidermis of patients with AD-like GVHD and LP-like GVHD [Figure 5]d,[Figure 5]e,[Figure 5]f.
In addition, we found that hBD2 expression was increased in lesions of patients with AD-like GVHD and LP-like GVHD, and hBD2 mRNA expression was also increased in lesions of patients with AD-like GVHD and LP-like GVHD.
The primer sequences were: [beta]-actin sense, CACGCCATCCTGCGTCGGAC; [beta]-actin antisense, CATGCCATCCTGCGTCTGGAC; hBD2 sense, TTCCTGATGCCTCTTCCA; and hBD2 antisense, ATGTCGCACGTCTCTGA; hBD4 sense, GGCAGTCCCATAACCACATATTC; and hBD4 antisense, TGCTGCTATTAGCCGTTTCTCTT; IL8 sense, GGCTCTCTTGGCAGCCTTCCTG; and IL8 antisense, CTTCTCCACAACCGTCTCACCC; IL6 sense, CGAGCCCACCGGGAACGAAA; and IL6 antisense, GCTTCGTCAGCAGGCTGGCAT.
Relative quantities of hBD2, hBD4, IL8, and IL6 mRNA among different preparations were calculated as the ratio of the hBD2/[beta]-actin, hBD4/[beta]-actin, IL8/[beta]-actin, and IL6/[beta]-actin pixel intensities from three independent RT-PCR experiments.
Trefoil factor 3 isolated from human breast milk upregulates hBD2 and hBD4 in HT-29 cells