AAAT


Also found in: Medical.
AcronymDefinition
AAATAll America Auto Transport (car shipping)
AAATAdult Adolescent Alcohol Treatment (rehabilitation facility; Grand Junction, CO)
AAATArmy Advanced Aviation Technology
AAATAmerican Association for the Advancement of Technology
AAATAmerican Academy of Addiction Psychiatry
AAATAdvanced All Analysis Training
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
AaAt one point in time Israel had decided that it can give back Gaza, negotiate over the Golan, delineate final borders with Lebanon and Jordan, but it could never leave the West Bank, or allow the Palestinians to have their independent state there.
Read other articles by Kristoffer Aaat http:dissidentvoice.org/author/KristofferLarsson .
En las muestras positivas para VPH, con el sobrenadante de los cepillados cervicales y el ADN de plasma restaurado, se realizo tipificacion viral por PCR convencional de la region E6/E7 de los tipos virales 16 y 18 (VPH 16 iniciadores: sentido 5' ATCATCAAGAACACGTAG AG 3' y antisentido 5' GATCAGTTGTCTCTGGTTGC AAAT 3' y VPH 18 el sentido 5' GATTTCACAACAT AGCTGGG 3' y el antisentido 5' TGCCTTAGGTCCA TGCATAC 3').
London: AaAt the start of the season, you would have got pretty short odds on Hull City remaining in the Premiership come next May.
The papers from the workshop were published as AAAt Technical Report WS-07-06 and are available from AAAI Press.
The AAAT can be divided into two parts: the first focuses on assessing compliance with the standard proper in terms of records management; the second reflects the requirement for compliance with any relevant regulatory bodies' guidance on recordkeeping.
As a result of the growing and increasingly liquid market for swaps, Standard & Poor's will rate structured finance transactions with swaps from 'AAAt' rated derivative product companies.
The nine such DPCs currently operating around the world are rated Aaa by Moody's Investors Service and AAA or AAAt by Standard and Poor's, the highest ratings of these agencies, despite parents with no rating above single-A (Table 1) The first such DPCs were designed to achieve triple-A ratings because it was thought that many customers would insist on dealing only with the most highly rated intermediaries.[2] In 1995, however, four years after they first emerged, the structured DPCs still accounted for a relatively small share of markets in which the major intermediaries generally had substantially lower credit ratings.
In silico analysis undertaken at the National Center for Biotechnology Information (NCBI) identified genes involved in salinity tolerance, or rather, genes AY785147--SOS with 3660 bp and AF319481--CK1 with 4206 bp, described as: AY785147: SOS1-1-F, 5' GAAGAACTTTCGATGCAGGA-3 '; SOS1-1-R, 5'--ATTT C C C AG AAAT GAT G C AA-3'; SOS1-2F, 5'-TGGACAGATTAGCAGCAACA-3 '; SOS1-2-R, 5'-TTGGGTAGGAACAAGATCCA3' and SOS1-3-F, 5'-GCTCTAAT AAAGCGCACAGC-3 '; SOS1-3-R, 5' CCAACAATTACTTGGGTTGCGGGCTTCAG AAACTGACAGA-3'.
As the result of fear alone, he documented a list of things that could go wrong with a birth - from arrested birth (the baby won't come out) to an aaat exhausted mother who is simply unable to push.