AAATCArea Agency on Aging of Tarrant County (Fort Worth, TX)
Copyright 1988-2018, All rights reserved.
References in periodicals archive ?
Primers for qRT-PCR were: HULC sense, 5'-ACTCT GAAGT AAAGG CCGGA-3', HULC antisense, 5'-TGCCA GGAAA CTTCT TGCTT G-3'; GAPDH sense, 5'-CAGCC AGGAG AAATC AAACA G-3', GAPDH antisense, 5'-GACTG AGTAC CTGAA CCGGC-3' (Sangon, China).
2007)]; sodium hydrogen exchanger 4 [Slc9a4, F: CGGAGGAACCTGCCA AAATC, R: CGGAGGAACCTGCCAAAATC (Stiernet et al.
The primers used for PCR were L 5'-GGTGT GTGTT TAAGA TTTCA CA-3' (Lee & Kim 2003) and HC02198 5'-TAAAC TTCAG GGTGA CCAAA AAATC A-3' (Folmer et al.