AAGA

AcronymDefinition
AAGAAfrica Assemblies of God Alliance
AAGAAfrican American Graduate Association (University of North Carolina Wilmington and Virginia Commonwealth University)
AAGAApartment Association of Greater Augusta (Martinez, GA)
AAGAAfrican American Golf Association (est. 1993)
AAGAAcademic Achievement Graduate Assistantship (Michigan State University)
References in periodicals archive ?
Name Function Sequence, (a) 5'-3' U1A nDNA-P1 Primer P1 AATTCTAATACGACTCACTATAGGG * AGA ** GGCC [down arrow] CGGCATGTGGTGCATAA U1A nDNA-P2 Primer P2 TGCGCCTCTTTCTGGGTGTT U1A-beacon Probe-FAM (b) CGCATGC *** TGTAACCACGCACTCTCCTC- GCATGCG *** mtDNA-P1 Primer P1 AATTCTAATACGACTCACTATAGGG * AAGA ** AC [down arrow] GGGCTCTGCCATCTTAA mtDNA-P2 Primer P2 GTAATCCAGGTCGGTTTCTA mtDNA-beacon Probe-ROX CGTACG *** TGATATCATCTCAACTTAGTAT- CGTACG *** (a) * The T7 RNA promoter sequence that is part of the P1 primer is shown in italics.
Parliament argues that Article 2(1) on protected customers should be restricted to "all household customers connected to aagas distribution network".
AaGas storage group Portland Gas hopes to tie up financing that will allow it to start work on its delayed flagship UK storage scheme this summer, its chief executive said.