AAGA

AcronymDefinition
AAGAAfrica Assemblies of God Alliance
AAGAAfrican American Graduate Association (University of North Carolina Wilmington and Virginia Commonwealth University)
AAGAApartment Association of Greater Augusta (Martinez, GA)
AAGAAfrican American Golf Association (est. 1993)
AAGAAcademic Achievement Graduate Assistantship (Michigan State University)
References in periodicals archive ?
The Association of American Government Accountants (AAGA) began publishing The Government Accountant in 1907.
La otra serie de actividades culturales funciona como apoyatura de ese mercado, lugar de intercambio y multiplicacion de la atraccion de la Feria: "Expotrastiendas junto a AAGA realizan diversas acciones culturales, como ser seminarios, concursos, exhibiciones que fomentan y dinamizan el mercado de las artes" (11).
Si tratta di una presentazione piuttosto breve, senz'altro piu breve di quelle alle quali ci avevano abituato i piu recenti GCA: questo e probabilmente dovuto da una parte all'esigenza di contenere l'ampiezza del volume che, sebbene privo delle Appendici presenti in molti altri GCA, con le sue quasi 600 pagine e di gran lunga il piu ponderoso della serie; dall'altra, al fatto che molte tematiche generali relative ad Amore e Psiche sono state affrontate nel gia menzionato AAGA 2, considerato come una sorta di "companion" a GCA 2004 (p.
Name Function Sequence, (a) 5'-3' U1A nDNA-P1 Primer P1 AATTCTAATACGACTCACTATAGGG * AGA ** GGCC [down arrow] CGGCATGTGGTGCATAA U1A nDNA-P2 Primer P2 TGCGCCTCTTTCTGGGTGTT U1A-beacon Probe-FAM (b) CGCATGC *** TGTAACCACGCACTCTCCTC- GCATGCG *** mtDNA-P1 Primer P1 AATTCTAATACGACTCACTATAGGG * AAGA ** AC [down arrow] GGGCTCTGCCATCTTAA mtDNA-P2 Primer P2 GTAATCCAGGTCGGTTTCTA mtDNA-beacon Probe-ROX CGTACG *** TGATATCATCTCAACTTAGTAT- CGTACG *** (a) * The T7 RNA promoter sequence that is part of the P1 primer is shown in italics.
Tenders are invited for Bhawaniganj ward ke antargat mohlla mehndiganj me ayub se mona and saleem se aaga tak nali ewam interlocking ka kary
of bands No amplified 1 Ccac010 [(CA).sub.7]aca[(TA).sub.3] 17 2 CCac026 (AC)7 15 3 CCac036 (CATA)3ta(TG)6 11 4 Ccat006 (TA)7(CA)6 15 5 CCB1 (CA)10 16 6 CCB2 (CA)21 12 7 CCB4 (CA)31 16 8 CCB6 (CA)6 17 9 CCB7 (CT)16 16 10 CCB8 (CT)30 15 11 CCB9 (CT)22 16 12 CCB10 (CA)15 17 13 CCgtt002 (TGT)4 17 14 CCtc013 (TC)6 17 15 CCtta006 (ATT)21 16 16 CCttc002 (GAA)5g(GAA)5 13 17 CCttc005 (CA)8 17 18 CCttc006 (GAA)11gag(GAA)5 14 gaggaagag(GAA) 17 19 CCttc007 (GA)4ca(GA)4 16 cagagt(GA)8 20 CCttc008 (AC)7 16 21 CCttc012 (TTC)7 13 22 CCttc033 (CTT)8 17 23 ICPM1A08 (CA)6 15 24 ICPM1E10 (CA)7 17 25 ICPM1G01 (CA)8 17 26 ICPM1G04 (T)21 17 27 ICPM2BM08 (TG)5n(TG)5 15 28 ICPMCT20 (GA)14(AAGA)5 17 Total 437 Avg.
The Advisor to CM Sindh while visiting the exhibition of Bhuttto family's political struggle and journey appreciated the hard work by photojournalist Aaga Feroz.
Name Sequence ygaE-F1A(+BamH I) 5 -TTGGATCCGGTACTGTCCCCATTATGT ygaE-F1B(+Sal I) 5'-CCGTCGACATAGCCTTTTTGATTCACC ygaE-F2A(+Sal I) 5'-TAGTCGACGAGATGCTGGAAGATAAAC ygaE-F2B(+BamH I) 5'-CTGGATCCTCTGCTACACTTTTCTTTG ygaE-PA(+Nco I) 5'-AACCATGGAGATGACCGCCCTTTCCCAA ygaE-PB(+Sal I) 5'-AAGTCGACCTACATTTTTCCTGCCAT P-ompF-A 5'-GGA ATACCGTACTAA AGCA P-ompF-B 5'-GATACTGGATACCGA AAGA P-ompC-A 5'-ATCAGA ACAACACCGCTAA P-ompC-A 5'-GTTGCTGATGTCCTTACC TABLE 3: Gene expression changes in [DELTA]ygaE under hyperosmotic stress discussed in this study.
Tenders are invited for Tarring work in ranital chowk to ghamdi chowk and aaga chowk to shankar ghi bhandar marg under zone 05
Tenders are invited for Construction of Left turn and tarring work at Aaga chowk
Parliament argues that Article 2(1) on protected customers should be restricted to "all household customers connected to aagas distribution network".
AaGas storage group Portland Gas hopes to tie up financing that will allow it to start work on its delayed flagship UK storage scheme this summer, its chief executive said.Aa Andrew Hindle said the firm is talking to utilities and oil and gas firms about potential equity and debt arrangements that could help it secure the 450 million pounds needed to fund the storage site on the Isle of Portland in south west England.Aa The development, which is due to be available to store its first gas in 2013, has experienced about a year's delay after the credit crunch hit attempts by the company to raise funds.