AAGCAmerican Association for Gifted Children (est. 1946; Duke University; North Carolina)
AAGCAustralian Air Guitar Championships
AAGCAfrican Association for Guidance and Counselling
AAGCAll American Gourmet Company (Irving, TX)
AAGCAfrican American Genealogy Connection
AAGCAsian Assembly of God Church (Flushing, NY)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
The AAGC would consist of four main components: development and cooperation projects, quality infrastructure and institutional connectivity, capacity and skill enhancement and people-to-people partnerships.
It has been seen as being aimed at "countering the Belt and Road (the Silk Road Economic Belt and the 21st Century Maritime Silk Road Initiative)," as there is a high level of overlapping in geographic coverage and cooperation fields between the AAGC and the Belt and Road Initiative.
AAGC is a consortium of national and state organizations, as well as private-sector companies, representing a broad cross-section of meat, livestock and poultry production; agricultural input; grain marketing, handling and processing; feed manufacturing; and exporting interests.
The Alabama Association for Gifted Children (AAGC) Conference at The McWane Science Center in Birmingham, AL.
The Apartment Association of Greater Columbia (AAGC), Columbia, S.C., presented a check for $5,500 to Harvest Hope Food Bank as part of the "Pack a Pickup" campaign.
Organisations represented Organisation for Economic Co-operation and Development (OECD)--Miho Taguma International Centre for Career Development and Public Policy (ICCDPP)--John McCarthy International Association for Educational and Vocational Guidance (IAEVG)--Lester Oakes European Training Foundation (ETF)--Helmut Zelloth European Forum for Student Guidance (Forum Europeen de L'Orientation Academique) (FEDORA)--Gerhart Rott African Association for Guidance and Counselling (AAGC)--Dan-Bush Bhusumane
According to the American Association of Community Colleges (AAGC), the total is 10.4 million and climbing, when counting those enrolled for credit and noncredit programs.
Conceived on the same November trip, the Asia- Africa Growth Corridor (AAGC) offers an ambitious reboot of the partners' long-standing economic and development ties with the continent.
Conceived on the same November trip, the Asia-Africa Growth Corridor (AAGC) offers an ambitious reboot of the partners' long-standing economic and development ties with the continent.
Each sample (2 [micro]L cDNA) was tested with real-time SYBR Green PCR reagent (Life Technologies) with specific primers: 18S (forward: AGTCCCTG CCCTTTGTACACA; reverse: CGAT CCGAGGGCCTCACTA), GAPDH (forward: TGGCACAGTCAAGGCTGAGA; reverse: CTTCTGAGTGGCAGTGATGG), bone morphogenetic protein 2 (Bmp2) (forward: AAGC CAT C G AG G AACT TT CA GA; reverse: TCAC AGGA AATTTTGA GCTGGC), and osteocalcin (OCN): (forward: TCTGACAAAGCCTTCATGTCCA; reverse: AACGGTGGTGCCATAGAT).
Additional primers were designed on the basis of preliminary sequences to generate additional S segment coding region sequence (forward: HANSF3 5'-TGGATGTTAATTCCATCGA-3' and reverse: HANSR4 5'-GATAATGTTTCGTGCTTTCA-3'; forward: HANF0001 TAGTAGTAGACTCCTTGAGAAGCTACT and reverse: HANTASR2 TAGTATGCTCCTTGAR AAGC).
The Annual Alabama Association for Gifted Children (AAGC) Conference at The McWane Center in Birmingham, AL.