ACACB

AcronymDefinition
ACACBAcetyl Coenzyme A Carboxylase Beta
References in periodicals archive ?
A selected gene panel from the genes identified by microarray analysis data based on their involvement in adipogenesis-related processes, including AdipoQ, AP2, PPAR[gamma]2, CEBP[alpha], CNTFR, LPL, LIPE, ACACB, and PCK1, was chosen for validation using qRT-PCR (Figure 2(c)).
Among the upregulated genes, ACACB is part of the adipocytokine signaling pathway and CNTFR is known to prevent neuronal degeneration.
Name Sequence 1 AdipoQ F 5' GCAGTCTGTGGTTCTGATTCCATAC R 5'GCCCTTGAGTCGTGGTTTCC 2 AP2 F 5' TGGTTGATTTTCCATCCCAT R 5' GCCAGGAATTTGACGAAGTC 3 CEBPA F 5' TATAGGCTGGGCTTCCCCTT R 5' AGCTTTCTGGTGTGACTCGG 4 PPAR[gamma]2 F 5' TTCTCCTATTGACCCAGAAAGC R 5'CTCCACTTTGATTGCACTTTGG 5 PCK1 F 5' TTACCAATGTGGCCGAGACC R 5' GCACAAGGTTCCCCATCCTC 6 CNTFR F 5' GCGACTCTAGCCTTGTCACC R 5' GACTGTGTCTCTGGGCGTAG 7 LPL F 5' CTTGGAGATGTGGACCAGC R 5'GTGCCATACAGAGAAATCTC 8 LIPE F 5'AGCCACGATGGGTGGAATG R 5'ACCAGCGACTGTGTCATTGT 9 ACACB F 5' ACAGTCCTGAGATCCCCCTC R 5' GTTCAGCCGGGTGGACTTTA 10 [beta]-actin F 5' AGCCATGTACGTTGCTA