ACADL


Also found in: Medical, Wikipedia.
AcronymDefinition
ACADLAcyl-CoA Dehydrogenase, Long-Chain
References in periodicals archive ?
Lipid metabolism: The following genes were categorized into the lipid metabolism pathway: PLTP (lipid transport); SCD (lipogenesis); liver X receptor a, nuclear receptor subfamily 1, group H, member (LR1H3) (cholesterol metabolism); FABP3 (fatty acid transport); CPT2, ACADL, and ACOX2 (fatty acid oxidation); and FABP4 (adipocyte differentiation).
Sequences of primers used for qRT-PCR Forward primer Reverse primer ACAA2 AAGCCGCTAACGAGGCTGGC AAGCCGCTAACGAGGCTGGC ACADL AACATGGCGGCATCGGTGGG AACATGGCGGCATCGGTGGG ACSL1 TGAGTGCATAGGCTCGGCGC TGAGTGCATAGGCTCGGCGC ACADVL CCCGAGTGTGGGGCGACAAC AGTCGCTGGGCAGAGGTAGGC CPT1[beta] TCCGAGGCAGGAGCCCCATC TCCGAGGCAGGAGCCCCATC ECH1 GAGGCCCTGGACAGTGGGCT GAGGCCCTGGACAGTGGGCT HADHA AACCCAGACCCGGCAGTGCT AACCCAGACCCGGCAGTGCT PDK4 GCGCACTTGCTCTCGCTCGA GCGCACTTGCTCTCGCTCGA PGC1[alpha] CACCAAGAAAGGGCCGGAGCA CACCAAGAAAGGGCCGGAGCA PGC1[beta] AAGGTCCCACCCCGATCCCG AAGGTCCCACCCCGATCCCG PPAR[alpha] AGGCCCTGCCTTCCCTGTGA GCGGGCCACAGAGCACCAAT Glutamate CTCTGCTGTCCCGCACCCG GTCGTCTTCGCGGTCGGTGG Dehydrogenase 18S ribosomal TAGAGGGACAAGTGGCGTTC CGCTGAGCCAGTCAGTGTAG
003 C-2 to C-3 short chain acyl-Coenzyme A dehydrogenase, ACADL 2.