ACADVL


Also found in: Medical, Wikipedia.
AcronymDefinition
ACADVLAcyl-CoA Dehydrogenase, Very Long-Chain
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Our study revealed that hepatic mRNA levels of FA oxidation CTP-1a and ACADVL genes and ACADM protein levels did not differ, although ACADM mRNA levels were lower in steers than in bulls.
Genomic DNA (g.DNA) (1-5 [micro]L) extracted from DBS was used for the optimization of standard and multiplex PCR amplifications followed by BigDye sequencing of the GALC, ACADM, ACADVL, GALT, and PAH genes.
Sequences of primers used for qRT-PCR Forward primer Reverse primer ACAA2 AAGCCGCTAACGAGGCTGGC AAGCCGCTAACGAGGCTGGC ACADL AACATGGCGGCATCGGTGGG AACATGGCGGCATCGGTGGG ACSL1 TGAGTGCATAGGCTCGGCGC TGAGTGCATAGGCTCGGCGC ACADVL CCCGAGTGTGGGGCGACAAC AGTCGCTGGGCAGAGGTAGGC CPT1[beta] TCCGAGGCAGGAGCCCCATC TCCGAGGCAGGAGCCCCATC ECH1 GAGGCCCTGGACAGTGGGCT GAGGCCCTGGACAGTGGGCT HADHA AACCCAGACCCGGCAGTGCT AACCCAGACCCGGCAGTGCT PDK4 GCGCACTTGCTCTCGCTCGA GCGCACTTGCTCTCGCTCGA PGC1[alpha] CACCAAGAAAGGGCCGGAGCA CACCAAGAAAGGGCCGGAGCA PGC1[beta] AAGGTCCCACCCCGATCCCG AAGGTCCCACCCCGATCCCG PPAR[alpha] AGGCCCTGCCTTCCCTGTGA GCGGGCCACAGAGCACCAAT Glutamate CTCTGCTGTCCCGCACCCG GTCGTCTTCGCGGTCGGTGG Dehydrogenase 18S ribosomal TAGAGGGACAAGTGGCGTTC CGCTGAGCCAGTCAGTGTAG FA utilization.
adipose [??]PPAR[gamma] INSIG1 Insulin induced gene 1 MAC-T [??]PPAR[gamma] SCD Stearoyl-CoA desaturase MDBK [??]PPAR[alpha] (delta-9-desaturase) SREBF1 Sterol regulatory element MAC-T [??]PPAR[gamma] binding factor 1 MDBK [??]PPAR[alpha] Fatty acid oxidation ACADVL Acyl-CoA dehydrogenase, MDBK [??]PPAR[alpha] very long chain Liver [??]PPAR[alpha] ACOX1 Acyl-coenzyme A oxidase 1 MDBK [??]PPAR[alpha] Liver ** [??]PPAR[alpha] CPT1A Carnitine MDBK [??]PPAR[alpha] palmitoyltransferase Liver ** [??]PPAR[alpha] 1A (liver) CPT2 Carnitine PAEC [??]PPAR[gamma] palmitoyltransferase 2 CRAT Carnitine O- PAEC [??]PPAR[gamma] acetyltransferase CYP4A11 Cytochrome P450, family Liver [??]PPAR[alpha] 4, subfam.