ACADVL


Also found in: Medical, Wikipedia.
AcronymDefinition
ACADVLAcyl-CoA Dehydrogenase, Very Long-Chain
References in periodicals archive ?
Our study revealed that hepatic mRNA levels of FA oxidation CTP-1a and ACADVL genes and ACADM protein levels did not differ, although ACADM mRNA levels were lower in steers than in bulls.
Genomic DNA (g.DNA) (1-5 [micro]L) extracted from DBS was used for the optimization of standard and multiplex PCR amplifications followed by BigDye sequencing of the GALC, ACADM, ACADVL, GALT, and PAH genes.
Sequences of primers used for qRT-PCR Forward primer Reverse primer ACAA2 AAGCCGCTAACGAGGCTGGC AAGCCGCTAACGAGGCTGGC ACADL AACATGGCGGCATCGGTGGG AACATGGCGGCATCGGTGGG ACSL1 TGAGTGCATAGGCTCGGCGC TGAGTGCATAGGCTCGGCGC ACADVL CCCGAGTGTGGGGCGACAAC AGTCGCTGGGCAGAGGTAGGC CPT1[beta] TCCGAGGCAGGAGCCCCATC TCCGAGGCAGGAGCCCCATC ECH1 GAGGCCCTGGACAGTGGGCT GAGGCCCTGGACAGTGGGCT HADHA AACCCAGACCCGGCAGTGCT AACCCAGACCCGGCAGTGCT PDK4 GCGCACTTGCTCTCGCTCGA GCGCACTTGCTCTCGCTCGA PGC1[alpha] CACCAAGAAAGGGCCGGAGCA CACCAAGAAAGGGCCGGAGCA PGC1[beta] AAGGTCCCACCCCGATCCCG AAGGTCCCACCCCGATCCCG PPAR[alpha] AGGCCCTGCCTTCCCTGTGA GCGGGCCACAGAGCACCAAT Glutamate CTCTGCTGTCCCGCACCCG GTCGTCTTCGCGGTCGGTGG Dehydrogenase 18S ribosomal TAGAGGGACAAGTGGCGTTC CGCTGAGCCAGTCAGTGTAG FA utilization.
Enzima Gen Posicion Gen Exon cromosomica (kpb) numero OCTN2 SLC22A5 5q33 25.8 10 CACT SLC22A2 3p21 16.5 9 CPTI CPT1A 11q13 60.03 18 CPTII CPT2 22q13 17.8 5 VLCAD ACADVL 17p11 5.3 20 LCHAD HADHA 2p23 54.0 20 LCKAT HADHB 2p23 45.5 16 MCAD ACADM 1p31 38.0 12 SCHAD HADHSC 4q22 45.5 9 SCAD ACADS 12q22 13 10 ETF ETFA 15q23 110.6 12 ETFB 19q13 21.2 6 Enzima cDNA Total de Total de (kpb) mutaciones mutaciones nulas variables reportadas reportadas OCTN2 1.7 7 13 CACT 0.9 6 -- CPTI 2.3 -- 2 CPTII 2.0 3 20 VLCAD 2.0 34 47 LCHAD 2.3 5 5 LCKAT 1.4 1 4 MCAD 1.3 7 15 SCHAD 0.9 -- 1 SCAD 1.2 -- 13 ETF 1.0 2 8 0.8 1 2
adipose [??]PPAR[gamma] INSIG1 Insulin induced gene 1 MAC-T [??]PPAR[gamma] SCD Stearoyl-CoA desaturase MDBK [??]PPAR[alpha] (delta-9-desaturase) SREBF1 Sterol regulatory element MAC-T [??]PPAR[gamma] binding factor 1 MDBK [??]PPAR[alpha] Fatty acid oxidation ACADVL Acyl-CoA dehydrogenase, MDBK [??]PPAR[alpha] very long chain Liver [??]PPAR[alpha] ACOX1 Acyl-coenzyme A oxidase 1 MDBK [??]PPAR[alpha] Liver ** [??]PPAR[alpha] CPT1A Carnitine MDBK [??]PPAR[alpha] palmitoyltransferase Liver ** [??]PPAR[alpha] 1A (liver) CPT2 Carnitine PAEC [??]PPAR[gamma] palmitoyltransferase 2 CRAT Carnitine O- PAEC [??]PPAR[gamma] acetyltransferase CYP4A11 Cytochrome P450, family Liver [??]PPAR[alpha] 4, subfam.