ACC1

AcronymDefinition
ACC1Acetyl Co(-enzyme) A Carboxylase 1
References in periodicals archive ?
For the present study, specific oligonucleotides for qRT-PCR were designed from the partial sequences of EF1, FAS, ACC1 of Atractosteus tropicus registered in the Gen Bank (Accession numbers: KT351350, KT351352, and KT351353, respectively) (Table 2).
The liver relative ACC1 mRNA expressions (means [+ or -] SE of 8-10 mice per group) were 3.23 [+ or -] 1.48 for the C group and 23.25 [+ or -] 8.23, for FR group (P<0.05).
The expression of ACC1 was upregulated from L1 to L3 (Table 6).
Marcinko et al., "Single phosphorylation sites in Acc1 and Acc2 regulate lipid homeostasis and the insulin-sensitizing effects of metformin," Nature Medicine, vol.
The scientists demonstrated that the described inhibition of ACC1 leads to the accumulation of the fatty acid precursor acetyl-CoA.
Gene Primer sequence (5' [right arrow] 3') Srebp1c F GGAGCCATGGATTGCACATT R GCTTCCAGAGAGGAGGCCAG Acc1 F CCTCCGTCAGCTCAGATACA R TTTACTAGGTGCAAGCCAGA Fasn F TGGGTTCTAGCCAGCAGAGT R ACCACCAGAGACCGTTATGC Scd1 F GGAGAGAATTTCATCTTCCA R CTTCCCAAAGCGGTGTGAGT Beta-actin F GAGACCTT CAACACCCCAGC R ATGTCACGCACGATTTCCC
In vivo study Decreased the expression of Fas and acetyl-CoA carboxylase 1 (ACC1), which are involved in lipogenesis, and liver X receptor a (LXR a), and 5-hydroxy-3- [27] methylglutaryl-coenzyme A reductase (HMG-CoAR), which are involved in cholesterol metabolism.
miR-26a targeted several key genes in lipid metabolism, including Acc1, Acc2, Acly, Dgat2, Fasn, Lipc, Scd1, and Srebf1 (Figure 3).
Table 2 Variables and Measures to Absorptive Capacity Variables Measures Acquisition ACC1 - The company has the capacity to capture Capacity relevant, continuous, up-to-date information and knowledge on current and potential competitors.
Next, 10 [micro]L of the PCR products, containing the amplified nagt region (1.4 kb), was digested with the fast digestion Acc1 (Xmi1) restriction enzyme (Fermentas GmbH, Thermo Scientific, Germany) in accordance with the manufacturer's instructions.
One is placed on the right hand (Acc1), a second one above the right knee (Acc2) and the third one on the chest (Acc3).
For example, in ACC criterion that covers area related to Access to Care and Continuity, all of the relevant standards in this area have been listed as each number and title (ACC1, ACC2, ACC3 ...).