ACTB


Also found in: Medical.
AcronymDefinition
ACTBActin, Beta
ACTBAIDS Committee of Thunder Bay (now AIDS Thunder Bay; Canada)
ACTBAlbany County Tourism Board (Laramie, WY)
ACTBAviation Combat Test Branch (Marine Corps Operational Test & Evaluation Activity)
ACTBAdvanced Chemical Technology Building (University of Illinois at Chicago)
References in periodicals archive ?
All target gene transcripts were normalized to ACTB expression, which was not affected by treatment.
In the present study, the six housekeeping genes, B2M, ACTB, EF-1a, GAPDH, 18S rRNA, and 40S, in different tissues, gender, and gonads of Yellow River carps at various developmental stages, including undifferentiated larvae (40-55 day after hatch (dph)), 1-year-old juveniles, and 2-year-old adult carps, were investigated.
Abbreviations: ACACA, acetyl-CoA carboxylase or, ACTB, actin, beta; ALA, [alpha]-linolenic acid; CL Cirsium brevicaule A GRAY leaves; EI-MS, electron ionizationmass spectrometry; FA, fatty acid; FASN.
Indeed, the association of ACTB with a wide range of cancer types (liver, renal, colorectal, gastric, pancreatic, esophageal, lung, breast, prostate, and ovarian cancers and leukemia, melanoma, and lymphoma) has been explained [34] and that of ACTBL2 in some hepatocellular carcinoma has been reported [35].
001 HSP90AA1, HSP90AB1, HSPB1, ITGB4, TPM1, TPM3, TUBB, TUBB3, TUBB4A Cellular growth ACTB, ACTN4, 33 < .
GBAN bp ACTB se, 5'-AGCCATGTACGTAGCCATCC-3' NM_031144 115 as, 5'-ACCCTCATAGATGGGCACAG-3' LEP se, 5'-GAGACCTCCTCCATCTGCTG-3' NM_013076 192 as, 5'-CTCAGCATTCAGGGCTAAGG-3' NPY se, 5'-TACTCCGCTCTGCGACACTA-3' NM_012614 115 as, 5'-GGGCATTTTCTGTGCTTTCT-3' se: sense; as: antisense; GBAN: GenBank Accession Number; amplicon length, in bp.
The ACTB will house select UIC faculty from chemistry, biology and physics and support cutting-edge research focused on connections between chemistry, physics and biology, such as tumor growth, HIV/AIDS, immunology, dental services, orthopedics, laser dynamics, nanoscience and environmental science.
Para normalizar los datos se empleo el gen para [beta]-actina de 101 pares de bases, cuyo primersentido es el ACTB R (0,5 [micron]M), 5' ACT CCT GCT TGC TGA TCC AC 3'y el primer antisentido es el ACTB L (0,5 [micron]M), 5' GAT CAT TGC TCC TCC TGA GC 3'.
67) The old version of the ACTB requirement placed a premium on where the active businesses were located in the corporate structure.
IONMASTER ACTB is designed for rinse water recycling and rinse water recovery.
Primer sequences, product sizes, and accession numbers used for gene expression analysis mRNA Primer sequences (5'-3') Product size Gene access (base pair) number ACTB F : TCCCTGGAGAAGAGCTACGA 154 U07786.
For CD 163 (Hs00174705_m1), ACTB (Hs99999903_m1), and GAPDH (Hs03929097_g1) were manufactured by Applied Biosystems and real-time PCR was carried out with using the ViiA[TM]7 Real-Time PCR System.