ACTB


Also found in: Medical.
AcronymDefinition
ACTBActin, Beta
ACTBAdvanced Chemical Technology Building (University of Illinois at Chicago)
ACTBAIDS Committee of Thunder Bay (now AIDS Thunder Bay; Canada)
ACTBAlbany County Tourism Board (Laramie, WY)
ACTBAviation Combat Test Branch (Marine Corps Operational Test & Evaluation Activity)
References in periodicals archive ?
For LIN28B mRNA expression, ACTB was selected as the reference gene, and its quantification cycle was used to normalize the mRNA levels of the target gene.
after copulation; ACTB, [beta]-actin; AFO, after first ovipositon; AFP, after first pause in oviposition; AG, albumen gland; AG-CG, albumen gland-capsule gland complex; ARO.
Primer sequences and primer annealing temperature used on qRT-PCR analysis Gene Sequence Annealing temperature ([degrees]C) TFF1 FOR: TTTGGAGCAGAGAGGAGGCAATG 63.3 [degrees]C REV: ACCACAATTCTGTCTTTCACGGGG TFF2 FOR: CCCATAACAGGACGAACTGC 55.7 [degrees]C REV: GCACTGATCCGACTCTTGCT TFF3 FOR: CTTGCTGTCCTCCAGCTCT 64.5 [degrees]C REV: CCGGTTGTTGCACTCCTT ACTB FOR: AAGCACCAGGGCGTGAT 63.3 [degrees]C REV: TCGTCCCAGTTGGTGACGA TFF1 = trefoil factor family 1 gene; TFF2 = trefoil factor family 2 gene; TFF3 = trefoil factor family 3 gene; ACTB = actin beta gene Table 2.
Cycle threshold values were normalized to ACTB, and FC was assessed relative to nonsmokers using the [DELTA][DELTA]Ct method.
For real-time qPCR, the TaqMan Gene Expression Assays on Demand (AoD) for ACTB (Hs03023943_g1), MDM2 (Hs01066942_m1), and P14/ARF (Hs99999189_m1) were used (Applied Biosystems[R]; CA, USA).
AGO2F ggaggtctgtaacattgtgg, AGO2R gcaatagctttatttc ctgccc; ACTB F cctggcacccagcacaat, ACTB R gggccggactcgt catact; and MALAT-1 F aaagcaaggtctccccacaag, MALAT-1 R ggtctgtgctagatcaaaaggca.
The cellular localization of SNHG3, ACTB, and RNU6 in NSLSC cell lines A549 and H1299.
Gene Gene description Sequences of primer symbol (mouse) NLRP3 NATCH-, LRR-, and Forward AGGAGGAAGAAGAAGAGAGGA PYD-containing protein 3 Reverse AGAGACCACGGCAGAAGC IL-1[beta] Interleukin-1 beta Forward TTCAGGCAGGCAGTATCAC Reverse CAGCAGGTTATCATCATCATCC Casp-1 Caspase-1 Forward CGTCTTGCCCTCATTATCTG Reverse TCACCTCTTTCACCATCTCC ACTB [beta]-Actin Forward GTGCTATGTTGCTCTAGACTTCG Reverse ATGCCACAGGATTCCATACC Figure 3: NLRP3 inhibition reduced the neurological deficit score in diabetic mice.
Three housekeeping genes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), [beta]-actin (ACTB), and histone deacetylase 1 (HDAC1), were examined.
These proteins are important in neuronal differentiation, and regeneration proteins like ACTB, GSK3B, CREB1, and CTNNB1 have physical interaction with coexpressed proteins [58].