ADH4


Also found in: Medical.
AcronymDefinition
ADH4alcohol dehydrogenase 4 gene
References in periodicals archive ?
Eight primers were successful in amplifying DNA in the sample viz., SCYOR267C, C5, C11, SC8132X, ADH1, ADH3, ADH4 and ADH7primers, For all loci, 20il reaction mixture containing genomic DNA concentration of 25 ng/ml, primer concentration of 10 pM/il and dNTPs 2.5mM, 10X buffer and 1 unit of Taq polymerase were used.
To see how ADH4 evolved, Benner's team read the stretches of DNA that make ADH4 in 27 modern primate species, including lemurs, monkeys, apes and humans.
Polymorphism of the human alcohol dehydrogenase 4 (ADH4) promoter affects gene expression.
Caption: Gel profile of yeast isolates generated using ADH4 primer Lane 1: YFN, 2: YMO, 3: YMM, 4: YYPO, 5: YGP, 6: YSJ, 7: YPA, 8: YWM, 9: YAP, 10: YBA, L-Ladder.
No Locus Primer Sequences (5CE'-3CE') 1 ARS304 (ADH1) F:GCAAAGTTATTATGTTAAAGAAAAAG R:ATATTCGTTGTAAACTCATATACTTA 2 ARS310 (ADH2) F:ACGTCTCCTCCAAGCCC R:CATATTCCCTAGAAAAA 3 ARS313(ADH3) F:GAAAAGATTTGATGAAGACCAA R:AAGCTACTTTTAAATAAGTTTT 4 ARS923(ADH4) F:CTAGTGCTTAAGTTCT R:GAGTTTAATTTGTTGT 6 ARS 207(ADH6) F:GTGTTAGTACGTTAAATGCTACGACT R:TTGAGTTTGTACAAAGGAAAGCTGTA 7 ARS111(ADH7) F:CGGCTATACAACCATATTTAAGTAAA R:GCAAAAACTCCTCTTTGTCTT 8 ARS1218 (ADH8) F:TTTTTTTAAGGGAAAATGCAAGCGTTTT R:CACCGATTTTTTGGATAAAATGTATTC Specific primers were designed using the Saccharomyces cerevisiae genome database (SGD; www.yeastgenome.org).
For example, several studies found other variations in and near the ADH1B gene, as well as in or near the ADH4, ADH1C, ADH5, ADH6, and ADH7 genes that affect risk for alcoholism or the level of alcohol consumption (see the article by Hurley and Edenberg, pp.
Some of the COGA victories include associations that have been subsequently substantiated by other investigations, such as GABA receptor alpha (GABRA2), cholinergic muscarinic 2 receptor (CHRM2), and ADH4 (Edenberg and Froud 2006).
* The ADH4 gene is expressed almost exclusively in the liver (Hurley et al.
Humans have seven different genes, called ADH1A, ADH1B, ADH1C, ADH4, ADH5, ADH6, and ADH7, that encode medium-chain ADHs (see Table 1).
ADH1 (an enzyme variant [i.e., isozyme] belonging to the class I ADH) is the most efficient for this substrate, ADH4 is about 10 times less efficient, and ADH3 is nearly inactive toward alcohol.
At high concentrations, alcohol is eliminated at a high rate because of the presence of enzyme systems with high activity levels ([K.sub.m]), (2) such as class II ADH, [[beta].sub.3]-ADH (encoded by ADH4 and ADH1B genes, respectively) and CYP2E1 (Bosron et al.