AP2


Also found in: Medical, Wikipedia.
AcronymDefinition
AP2American Pie 2 (movie)
AP2Activator Protein 2 (also seen as AP-2)
AP2Adipocyte Protein 2
AP2Austin Powers 2: The Spy Who Shagged Me (movie)
References in periodicals archive ?
Gene Forward primer 5'-3' Reverse primer 5'-3' PPAR[gamma] CCAGAGTCTCCTGATCTGCG GCCACCTCRRRCCTCTGCTC aP2 AAGTGGGAGTGGGCTTTGC TCCCCATTTACGCTGATGATC GAPDH TGGCAAAGTGGAGATTGTTGCC AAGATGGTGATGGGCTTCCCG
Buna ek olarak ilerleyen yasla birlikte ayak bilegi guc grafiklerinde absorbsiyon bolumunde (Ap1) azalma, guc uretimi bolumunde (Ap2) artma gozlendigini, yine ilerleyen yasla birlikte kalca hareketi sirasindaki hem baslangictaki kalca ekstansor guc uretimi (Hp1) hem de ilk salinim fazindaki kalca f leksor guc uretiminin (Hp3) azaldigini bildirmislerdir.
El caso 3 identifica un escenario en el cual cada usuario se conecta a un AP diferente, por ejemplo el jugador 1 selecciona el AP1 y por lo tanto el jugador 2 selecciona el AP2, por lo tanto, la estrategia que maximiza la utilidad de cada jugador es seleccionar el maximo ancho de banda posible para cada AP el cual es ([[beta].sub.i,kmax] = 60MHz).
The mRNA expression with densitometry of several transcription factors associated with adipocyte differentiation such as PPAR-[gamma], C/EBP[alpha], SREBP-1c, FAS, and aP2 were analyzed to determine the molecular mechanism governing how increasing concentrations of AGN enhances adipocyte differentiation.
On the other hand, the LOS antenna ([[phi].sub.i,0,0,0], i = 1,2.) angles for AP1 and AP2 values can be calculated as
Primary antibodies for aP2 and LPL (both from R&D Systems), adipsin (Santa Cruz Biotechnology), and [beta]-actin (13E5; Cell Signaling Technology), as well as appropriate horseradish peroxidase-labeled secondary antibodies were used.
The AP2's interior needed to be saved because it still had potential.
Previous researches in molecular level have suggested that gene Q is a member of transcription factor AP2 (APETALA2) family, which is also called WAP2 gene (Simons et al., 2006).
"Investing in ADB's Green Bond is a natural way for AP2 to expand our green investments into a region with large environmental challenges and opportunities.
A standardized pattern of consecutive images was acquired at each time point in the following order: SAXB, SAXM, AP4, AP2, and AP3.
The RSSs measured from the receiver points for AP2 in the indoor WLAN and the ML-ANN test results are compared and shown in Fig.
Vendor: AMF, GAMCO Asset Management Inc, Alecta, AP4, AP2, Other minority shareholders, Investor AB